* Pour découvrir les actions du virus en vue de le détecter et de trouver un traitement. Bien sûr!

Voir ci-dessous le texte en Français du brevet (traduction google sommaire).

http://www.google.com/patents/US20120251502

Source : Conscience du Peuple

Ebola virus de l’ espèce humaine  , composition et méthode de corderie

APPLICATIONS CONNEXES

Cette demande revendique un bénéfice de priorité de la demande provisoire US 61/108, 175 déposée le 24 oct. 2008; les contenus sont incorporés ici par référence.

DÉPÔT DES MOTIFS

L’invention fournit la Ebola humain isolé (hEbola) virus désignés comme Bundibugyo (EboBun) déposés auprès des Centers for Disease Control and Prevention (« CDC », Atlanta, Géorgie, États-Unis d’Amérique) le 26 novembre 2007 et accordé une numéro d’accession 200.706.291. Ce dépôt n’a pas été faite à une autorité internationale de dépôt (IDA) établi en vertu du Traité de Budapest sur la reconnaissance internationale du dépôt des micro-organismes aux fins de la procédure des brevets, et est un dépôt de traité de non-Budapest. L’organisme déposé n’est pas acceptable par l’American Type Culture Collection (ATCC), Manassas, en Virginie, une autorité de dépôt internationale (IDA) établi en vertu du Traité de Budapest sur la reconnaissance internationale du dépôt des micro-organismes aux fins de la procédure en matière de brevets. Des échantillons du dit fort adhésion n ° 200706291 seront mis à la disposition des établissements approuvés pour les trente ans à la date du dépôt, et pour la durée de vie de la délivrance du brevet de, ou revendiquant la priorité de cette demande.

DOMAINE DE L’INVENTION

L’invention se rapporte à des compositions et des méthodes destinées à une nouvelle espèce de virus Ebola humain (hEbola).

CONTEXTE DE L’INVENTION

Le Filoviridés familiale se compose de deux genres, Marburg et Ebola, qui ont probablement évolué à partir d’un ancêtre commun 1 . Le genre Ebola comprend quatre espèces: Zaïre, Soudan, Reston et la Côte d’Ivoire (Côte d’Ivoire) ebolaviruses, qui ont, à l’exception de Reston et ebolaviruses Côte d’Ivoire, été associés avec une grande fièvre hémorragique (FH) des épidémies en Afrique avec un taux de létalité cas (53 à 90%) 2 .

Les virus de chacune des espèces ont des génomes qui sont au moins 30 à 40% divergent les uns des autres, un niveau de diversité qui reflète probablement des différences dans la niche écologique et qu’ils occupent dans leur évolution. Identification du réservoir naturel de ebolaviruses reste quelque peu insaisissable, bien que récente PCR et les données suggèrent que les anticorps trois espèces de chauves-souris frugivores arboricoles peuvent être porteurs de virus Ebola Zaïre 3 . Aucune donnée n’a été publiée pour suggérer des réservoirs pour le Soudan, Reston et espèces de virus Ebola Côte d’Ivoire. Cependant, une chauve-souris frugivore troglodytique a été récemment impliqué comme un hôte naturel pour Marburg 4, 5 , soutenant l’hypothèse que les différentes espèces de chauves-souris peuvent être les hôtes réservoirs pour les différents filovirus.

Foyers filovirus sont sporadiques, parfois entrecoupés par des années ou même des décennies d’inactivité de la maladie apparente. Les dernières nouvelles espèces de virus Ebola a été découvert il ya 14 ans (1994), en Côte d’Ivoire (Côte-d’Ivoire), et participent d’un seul cas non mortel, un vétérinaire qui a effectué une autopsie sur un chimpanzé infecté trouvé dans la forêt de Tai 6 . Aucun autre rapport de la maladie ont été associés avec la Côte d’Ivoire Ebola, contrairement à ebolaviruses Zaïre et le Soudan qui ont chacun causé plusieurs grandes épidémies au cours de la même période.

À la fin de Novembre 2007, le cas HF ont été signalés dans les cantons de Bundibugyo et Kikyo dans le district de Bundibugyo, en Ouganda occidental. L’épidémie a continué à Janvier 2008 et a donné lieu à environ 149 cas et 37 décès 2 . Les analyses de laboratoire des premiers spécimens 29 suspect cas sang par des méthodes classiques (capture de l’antigène, IgM et IgG ELISA) et une approche de pyroséquençage amorçage aléatoire récemment développé identifié qu’il s’agit d’une épidémie d’Ebola HF associé à une nouvelle espèce de virus Ebola découvert. Ces échantillons ont été négatifs lorsqu’elle est initialement testé avec en temps réel analyses RT-PCR très sensibles spécifiques pour tous les ebolaviruses connus Zaïre et le Soudan et les virus de Marburg. Cette nouvelle espèce est désignée ici comme «les espèces Bundibugyo », en abrégé « EboBun ».

En conséquence, les compositions et les méthodes visant à la nouvelle espèce de virus Ebola sont décrits ici et les espèces les plus étroitement liés à Ebola Côte d’Ivoire, qui compositions et méthodes sont utiles pour le diagnostic et la prévention de l’infection par le virus Ebola humaine; y compris le développement d’un vaccin est associée, et la prévention de la fièvre hémorragique dans une population humaine.

RESUME DE L’INVENTION

La présente invention est basée sur l’isolement et l’identification d’une nouvelle espèce de virus Ebola humain, EboBun. EboBun a été isolé à partir de patients souffrant de fièvre hémorragique dans une récente épidémie en Ouganda. Le virus isolé est un membre de la famille des Filoviridae, une famille de virus à ARN négatif de détection. En conséquence, l’invention concerne le virus de la EboBun isolé qui concerne le plan morphologique et phylogénétique de membres connus Filoviridae.

Dans un aspect, l’invention concerne le virus isolé EboBun déposé avec les Centers for Disease Control and Prevention (« CDC », Atlanta, Géorgie, États-Unis d’Amérique) le 26 novembre 2007 et accordé un numéro d’accession 200.706.291, comme indiqué dans le paragraphe intitulé «DÉPÔT DES MOTIFS » ci-dessus.

Dans un autre aspect, l’invention fournit un virus hEbola EboBun isolé comprenant une molécule d’acide nucléique comprenant une séquence nucléotidique choisie dans le groupe constitué par: a) une séquence nucléotidique présentée dans SEQ ID NO: 1; b) une séquence nucléotidique qui s’hybride à la séquence présentée dans SEQ ID NO: 1 en vertu des conditions strictes; et c) une séquence nucléotidique qui a au moins 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% d’identité avec la SEQ ID NO: 1 Dans. un autre aspect, l’invention fournit la séquence génomique complète du virus de EboBun hEbola.

Dans un aspect apparenté, l’invention fournit des molécules d’acide nucléique isolées à partir EboBun, ou des fragments de ceux-ci.

Dans un autre aspect, l’invention fournit des protéines ou des polypeptides qui sont isolés à partir de la EboBun, y compris les protéines virales isolées à partir de cellules infectées par le virus mais pas dans les cellules non infectées comparables; ou des fragments de ceux-ci. Dans un mode de réalisation de la présente invention, les séquences d’acides aminés des protéines ou des polypeptides sont définies dans les SEQ ID NOS: 2-9 et 59, ou des fragments de ceux-ci.

Dans un aspect apparenté, l’invention fournit un polypeptide isolé codé par la molécule d’acide nucléique du virus de l’invention hEbola EboIC (Séquence ID n ° 10) décrit ci-dessus.

Dans un autre aspect, l’invention fournit un virus hEbola EboIC isolé comprenant une molécule d’acide nucléique comprenant une séquence nucléotidique choisie dans le groupe constitué par: a) une séquence nucléotidique présentée dans SEQ ID NO: 10; b) une séquence nucléotidique qui s’hybride à la séquence présentée dans SEQ ID NO: 10 dans des conditions stringentes; et c) une séquence nucléotidique qui a au moins 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% d’identité avec la SEQ ID NO: 10. En un autre aspect, l’invention fournit la séquence génomique complète du virus hEbola EboIC.

Dans un aspect apparenté, l’invention fournit des molécules d’acide nucléique isolées à partir EboIC, ou des fragments de ceux-ci.

Dans un autre aspect, l’invention fournit des protéines ou des polypeptides qui sont isolés à partir de la EboIC, y compris les protéines virales isolées à partir de cellules infectées par le virus mais pas dans les cellules non infectées comparables; ou des fragments de ceux-ci. Dans un mode de réalisation de la présente invention, les séquences d’acides aminés des protéines ou des polypeptides sont définies dans les SEQ ID NOs: 11 à 19, ou des fragments de ceux-ci.

Dans un aspect apparenté, l’invention fournit un polypeptide isolé codé par la molécule d’acide nucléique du virus de l’invention décrit ci-dessus hEbola EboIC.

Dans d’autres aspects, l’invention concerne l’utilisation du virus isolé hEbola pour des méthodes diagnostiques et thérapeutiques basées sur EbBun, EboIC, ou une combinaison de ceux-ci. Dans un mode de réalisation, l’invention fournit un procédé de détection dans un échantillon biologique d’un Anticorps immunospécifique pour le genre de l’Ouest Afrin Ebola espèces constituant hEbola EbBun et virus EboIC l’aide d’au moins un virus de l’invention isolé hEbola décrit ici, ou l’une quelconque des protéines de l’invention ou polypeptides tels que décrits ici. Dans un autre mode de réalisation spécifique, l’invention fournit un procédé de criblage d’un anticorps qui se lie de manière immunospécifique et neutralise hEbola EboBun. Un tel anticorps est utile pour une immunisation passive ou une immunothérapie d’un sujet infecté par le hEbola.

Dans un autre aspect, l’invention propose un anticorps isolé ou un fragment de liaison d’antigène de celui-ci qui se lie de manière immunospécifique à la hEbola virus de l’invention décrit ci-dessus.

Dans d’autres aspects, l’invention fournit des méthodes pour la détection de la présence, de l’activité ou de l’expression du virus de la Clairière Bundibungyo-Côte d’Ivoire hEbola dans une matière biologique, tels que les cellules, le sang, la salive, l’urine, les fèces et ainsi de suite; et plus particulièrement au moins un des EbBun ou EboIC.

Dans un aspect apparenté, l’invention fournit un procédé pour détecter la présence du virus de l’invention décrit ci-dessus hEbola dans un échantillon biologique, le procédé comprend (a) la mise en contact de l’échantillon avec un agent qui se lie sélectivement à un virus hEbola Afrique de l’Ouest; et (b) détecter si le composé se lie au virus hEbola Afrique de l’Ouest dans l’échantillon.

Dans un autre aspect, l’invention fournit un procédé pour détecter la présence du polypeptide de l’invention décrit ci-dessus, dans un échantillon biologique, ledit procédé comprend (a) la mise en contact de l’échantillon biologique avec un agent qui se lie sélectivement au polypeptide; et (b) détecter si l’agent se lie au polypeptide dans l’échantillon. Dans un autre aspect, l’invention fournit un procédé pour détecter la présence d’une première molécule d’acide nucléique provenant du virus de l’invention hEbola décrit ci-dessus dans un échantillon biologique, le procédé comprenant: (a) mettre en contact l’échantillon biologique avec un agent qui se lie sélectivement à le polypeptide; et (b) détecter si l’agent se lie au polypeptide dans l’échantillon.

Dans un autre aspect, l’invention fournit un procédé pour propager le virus hEbola dans des cellules hôtes comprenant l’infection des cellules hôtes par le virus hEbola isolé selon l’invention décrit ci-dessus, mise en culture des cellules hôtes afin de permettre au virus de se multiplier, et la récolte des virions qui en résultent. Également fournis par la présente invention sont des cellules hôtes infectées par le virus de l’invention décrit ci-dessus hEbola.

Dans un autre aspect, l’invention fournit un procédé de détection dans un échantillon biologique la présence d’un anticorps qui se lie de manière immunospécifique hEbola virus, le procédé comprenant: (a) mettre en contact l’échantillon biologique avec l’hôte de la cellule hôte selon l’invention décrit ci-dessus; et (b) la détection de l’anticorps lié à la cellule.

Dans un autre aspect, l’invention fournit des préparations de vaccin, comprenant le virus hEbola l’invention, y compris des formes recombinantes et chimères de virus, des molécules d’acides nucléiques constituées par le virus, ou sous-unités protéiques du virus. L’invention fournit aussi une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace du virus de l’invention hEbola décrit ci-dessus, et un support pharmaceutiquement acceptable. Dans un mode de réalisation, l’invention fournit une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’un extrait de protéine du virus de l’invention hEbola décrit ci-dessus, ou une sous-unité de celui-ci; et un support pharmaceutiquement acceptable. Dans une autre, la présente invention propose une formulation vaccinale comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans une autre, la présente invention propose une formulation vaccinale comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique selon l’invention comprenant l’un quelconque des séquences nucléotidiques telles que décrites ci-dessus, ou un complément de celle-ci, et un support pharmaceutiquement acceptable.

Dans un aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace du virus de l’invention hEbola décrit ci-dessus, et un support pharmaceutiquement acceptable. Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’un extrait de protéine du virus de l’invention décrit ci-dessus hEbola ou une sous-unité de celui-ci, et un support pharmaceutiquement acceptable. Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique selon l’invention tel que décrit ci-dessus ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’un quelconque des polypeptides de l’invention décrites ci-dessus.

Dans un autre aspect, la présente invention propose des compositions pharmaceutiques comprenant des agents antiviraux de la présente invention et un support pharmaceutiquement acceptable. Dans un mode de réalisation spécifique, l’agent antiviral de l’invention est un anticorps qui se lie de manière immunospécifique hEbola virus ou tout épitope hEbola. Dans un autre mode de réalisation spécifique, l’agent antiviral est un polypeptide ou une protéine de la présente invention ou d’une molécule d’acide nucléique de l’invention.

Dans un aspect apparenté, l’invention fournit une composition pharmaceutique comprenant une quantité prophylactiquement ou thérapeutiquement efficace d’un agent anti-hEbola EboBun et un support pharmaceutiquement acceptable.

L’invention fournit également des trousses contenant des compositions et des formulations de la présente invention. Ainsi, dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la formulation immunogène de l’invention décrit ci-dessus. Dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la formulation de vaccin selon l’invention décrit ci-dessus. Dans un autre, l’invention fournit un kit comprenant un récipient contenant la composition pharmaceutique selon l’invention décrit ci-dessus. Dans un autre, l’invention fournit un kit comprenant un récipient contenant la formulation de vaccin selon l’invention décrit ci-dessus. Dans un autre, l’invention fournit un procédé d’identification d’un sujet infecté par le virus de l’invention hEbola décrit ci-dessus, comprenant: (a) obtenir l’ARN total à partir d’un échantillon biologique obtenu à partir du sujet; (B) la transcription inverse de l’ARN total pour obtenir l’ADNc; et (c) l’amplification de l’ADNc en utilisant un ensemble d’amorces dérivées de la séquence nucléotidique du virus hEbola inventif décrit ci-dessus.

L’invention concerne en outre l’utilisation des informations de séquence du virus isolé pour des méthodes diagnostiques et thérapeutiques.

Dans un autre aspect, la présente invention propose des procédés pour le criblage d’agents antiviraux qui inhibent la replication ou l’infectivité des virus hEbola ou variants de ceux-ci.

L’invention propose en outre des procédés de préparation des formes recombinantes ou chimériques de hEbola.

BREVE DESCRIPTION DES DESSINS

Figue. 1 représente un arbre phylogénétique comparant les génomes complets de virus Ebola et Marburg par l’analyse bayésienne;

Figue. 2représente un alignement de génomes de nouveau hEbola EboBun (SEQ ID NO: 1), appelée ci-après « Ebola Bundibugyo » ou « EboBun », et hEbola Zaïre (SEQ ID NO: 20); ci-après dénommée « ’76 Ebola Zaïre» ou «EboZ » et hEbola Côte-d’Ivoire (SEQ ID NO: 10) également dénommée ci-après « EboIC ».

DESCRIPTION DETAILLEE DES MODES DE REALISATION PREFERES

Il doit être entendu que la présente invention n’est pas limitée aux modes de réalisation particuliers décrits en tant que tels peuvent, bien sûr, varier. Il est également entendu que la terminologie utilisée ici a pour but de décrire des modes de réalisation particuliers uniquement, et n’est pas destinée à être limitative.

En raison de la divergence de séquence de EboBun par rapport à tous les ebolaviruses comptabilisés antérieurement, la présente invention a une utilité dans la conception de tests de diagnostic pour surveiller la maladie d’Ebola HF chez les humains et les animaux, et de développer des antiviraux et des vaccins efficaces.

Le virus EboBun de la présente invention est génétiquement distinctes, qui diffèrent de plus de 30% au niveau de toutes les autres espèces connues du génome du virus Ebola. Le caractère unique de ce virus créé des défis pour les essais traditionnels de filovirus moléculaires à base de diagnostic et des approches de séquençage du génome. Au lieu de cela, plus de 70% du génome du virus a été séquencé en utilisant une approche de pyroséquençage amorçage aléatoire récemment mis au point qui a permis le développement rapide de test de détection moléculaire qui ont été déployées dans la réponse à la flambée de la maladie. Cette ébauche de la séquence de pyroséquençage amorçage aléatoire a permis l’achèvement rapide de la séquence du génome entier en utilisant l’approche de la marche traditionnelle de l’amorce et la confirmation que le virus EboBun représenté une nouvelle espèce de virus Ebola.

Définitions

Les définitions fournies ici sont opérationnels dans l’ensemble de la description de l’invention dans les présentes, y compris le résumé de l’invention.

L’expression « un anticorps ou un fragment d’anticorps qui se lie de manière immunospécifique à un polypeptide de l’invention», tel qu’utilisé ici, se réfère à un anticorps ou un fragment de celui-ci qui se lie de manière immunospécifique au polypeptide codé par la séquence nucléotidique de SEQ ID NO: 1 (EboBun), ou un fragment de celui-ci, et ne se lie pas de manière non spécifique à d’autres polypeptides. Un anticorps ou un fragment de celui-ci qui se lie de manière immunospécifique au polypeptide de l’invention peuvent réagir de façon croisée avec d’autres antigènes. De préférence, un anticorps ou un fragment de celui-ci qui se lie de manière immunospécifique à un polypeptide de l’invention ne cross-réagit pas avec d’autres antigènes. Un anticorps ou un fragment de celui-ci qui se lie de manière immunospécifique au polypeptide de l’invention peuvent être identifiés par, par exemple, des immunodosages ou d’autres techniques connues de l’homme de l’art, ou autrement, comme décrit ici.

Un «isolé» ou un peptide « purifié » ou la protéine est essentiellement exempte de matériau cellulaire ou autres protéines contaminantes de la source cellulaire ou tissulaire à partir de laquelle la protéine est dérivée, ou essentiellement exempte de précurseurs chimiques ou d’autres produits chimiques quand elle est synthétisée chimiquement. L’expression « pratiquement dépourvue de matière cellulaire» inclut des préparations d’un polypeptide / protéine dans laquelle le polypeptide / protéine est séparée des composants cellulaires des cellules à partir desquelles elle est isolée ou produite par recombinaison. Ainsi, un polypeptide / protéine qui est sensiblement exempte de matériau cellulaire comprend des préparations du polypeptide / protéine ayant moins d’environ 30%, 20%, 10%, 5%, 2,5% ou 1% (en poids sec) de protéine contaminante . Lorsque le polypeptide / protéine est produite par recombinaison, elle est également de préférence sensiblement exempte de milieu de culture, c’est à dire, le milieu de culture représente moins d’environ 20%, 10%, ou 5% du volume de la préparation protéique.

Lorsque polypeptide / protéine est produite par synthèse chimique, elle est de préférence sensiblement exempt de précurseurs chimiques ou d’autres produits chimiques, c’est à dire qu’elle est séparée des précurseurs chimiques ou d’autres produits chimiques qui sont impliqués dans la synthèse de la protéine. En conséquence, ces préparations de polypeptide / protéine ont moins d’environ 30%, 20%, 10%, 5% (en poids sec) de précurseurs chimiques ou de composés autres que le fragment de polypeptide / protéine d’intérêt. Dans un mode de réalisation préféré de la présente invention, des polypeptides / protéines sont isolées ou purifiées.

Une molécule «isolée» d’acide nucléique est une qui est séparée d’autres molécules d’acide nucléique qui sont présentes dans la source naturelle de la molécule d’acide nucléique. De plus, une molécule «isolée» d’acide nucléique, telle qu’une molécule d’ADNc, peut être sensiblement exempte d’autre matériau cellulaire, ou de milieu de culture lorsqu’elle est produite par des techniques recombinantes, ou sensiblement exempte de précurseurs chimiques ou d’autres produits chimiques quand elle est synthétisée chimiquement. Dans un mode de réalisation préféré de l’invention, des molécules d’acides nucléiques codant pour des polypeptides / protéines de l’invention sont isolés ou purifiés. Le terme « isolé » molécule d’acide nucléique ne comprend pas un acide nucléique qui est un membre d’une banque qui n’a pas été purifié à partir d’autres clones de la banque contenant d’autres molécules d’acide nucléique.

Le terme « portion » ou « fragment » tel qu’utilisé ici inclut les longueurs des fragments spécifiés, et tous les nombres entiers dans l’intervalle, y compris les points d’extrémité déterminées dans une plage spécifiée, et incluant toute la longueur jusqu’à la longueur totale d’une protéine, un polypeptide , ou un acide nucléique.

Le terme « ayant une activité biologique de la protéine » ou « ayant des activités biologiques des polypeptides de l’invention» fait référence à des caractéristiques des polypeptides ou des protéines ayant une activité biologique commune, similaire ou identique domaine structurel, et / ou amino ayant suffisamment acide identité avec le polypeptide codé par la séquence nucléotidique de SEQ ID NO: 1 (EboBun). Ces activités biologiques communes des polypeptides de l’invention comprennent l’antigénicité et l’immunogénicité.

L’expression «dans des conditions rigoureuses» se réfère à hybridation et de lavage des conditions dans lesquelles des séquences nucléotidiques présentant au moins 70%, au moins 75%, au moins 80%, au moins 85%, au moins 90%, ou d’au moins 95% d’identité avec l’autre restent hybridées les unes aux autres. De telles conditions d’hybridation sont décrites dans, par exemple, mais sans s’y limiter, Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989), 6.3.1-6.3.6; Méthodes de base en biologie moléculaire, Elsevier Science Publishing Co., Inc., New York (1986), pp 75-78, et 84-87; et Molecular Cloning, Cold Spring Harbor Laboratory, New York (1982), pp 387-389, et sont bien connus de l’homme de l’art. Un, exemple non limitatif préféré de conditions d’hybridation stringentes est une hybridation dans 6 x citrate de sodium / chlorure de sodium (SSC), 0,5% de SDS à environ 68 ° C suivi par un ou plusieurs lavages dans 2 x SSC, 0,5% SDS à manger température. Un autre exemple non limitatif préféré de conditions d’hybridation stringentes est une hybridation dans 6 x SSC à environ 45 ° C, suivi par un ou plusieurs lavages dans 0,2 x SSC, 0,1% SDS à environ 50-65 ° C.

Le terme «variante» tel qu’utilisé ici se réfère soit à un mutant d’origine naturelle génétique de hEbola EboBun, ou hEbola EboIC, ou préparé par recombinaison d’une variation de ces espèces hEbola, dont chacun contient une ou plusieurs mutations dans son génome par rapport à la hEbola d’ SEQ ID NO: 1. ou 10 Le terme « variant » peut également se référer soit à une variation d’origine naturelle d’un peptide donné ou une variation par recombinaison d’un peptide ou d’une protéine donnée dans laquelle un ou plusieurs résidus d’acides aminés ont été modifiés par un groupe amino substitution de l’acide, l’addition ou la suppression.

«Homologie» fait référence à une similarité de séquence ou, en variante, une identité de séquence entre deux ou plusieurs séquences polynucléotidiques ou deux ou plusieurs séquences polypeptidiques.

Les termes «identité en pour cent» et «% d’identité», tel qu’il est appliqué à des séquences de polynucléotides, se réfèrent au pourcentage de nucléotides identiques correspondances entre au moins deux séquences de polynucléotides alignées en utilisant un algorithme standard. Un tel algorithme peut insérer, de manière standardisée et reproductible, les lacunes dans les séquences comparées afin d’optimiser l’alignement entre deux séquences, et donc obtenir une comparaison plus significative des deux séquences.

Pour cent d’identité entre les séquences de polynucleotides peut être déterminée en utilisant un ou plusieurs algorithmes ou des programmes connus dans l’art ou décrits dans la présente informatiques. Par exemple, identité en pour cent peut être déterminée en utilisant les paramètres de l’algorithme CLUSTAL V par défaut comme incorporé dans le programme d’alignement de séquence de version 3.12e MEGALIGN. Ce programme fait partie du logiciel de LASERGENE, une série de programmes d’analyse biologique moléculaire (DNAstar, Madison, WI). CLUSTAL V est décrit dans Higgins, DG et PM Sharp (1989; CABIOS 5:151-153) et Higgins, DG et al. (1992; CABIOS 8:189-191). Pour les alignements par paires de séquences de polynucléotides, les paramètres par défaut sont définies comme suit: Ktuple = 2, pénalité de brèche = 5, fenêtre = 4 et diagonales sauvegardées «  » = 4. Le tableau de poids « pondérée » de résidu est sélectionné par défaut.

Alternativement, une suite d’algorithmes de comparaison de séquences couramment utilisés et librement disponibles qui peuvent être utilisés est fourni par le National Center for Biotechnology Information (NCBI) Local Alignment Search Tool base (BLAST) (Altschul, SF et al. (1990) J. Mol .. Biol 215:403-410), qui est disponible à partir de plusieurs sources, y compris le NCBI, Bethesda, Md., et sur le site Web de NCBI monde disponible sur Internet. La suite logicielle BLAST comprend différents programmes d’analyse de séquence, y compris « blastn », qui est utilisé pour aligner une séquence polynucléotidique connue avec d’autres séquences polynucléotidiques provenant de diverses bases de données. Également disponible est un outil appelé «BLAST 2 Sequences » qui est utilisé pour la comparaison par paires directe de deux séquences nucléotidiques. « BLAST 2 Sequences » peut être consulté et utilisé de manière interactive sur Internet via le site Web de NCBI mondiale ainsi. L’outil «BLAST 2 Sequences » peut être utilisé à la fois pour blastn et blastp (voir ci-dessous). programmes BLAST sont couramment utilisés avec écart et d’autres paramètres définis les paramètres par défaut. Par exemple, pour comparer deux séquences nucléotidiques, on peut utiliser blastn avec le «BLAST 2 Sequences » outil Version 2.0.12 (21 avril 2000) fixé à paramètres par défaut. De tels paramètres par défaut peuvent être, par exemple: Matrice: BLOSUM62; Récompense pour le match: 1; Pénalité pour non-concordance: -2; Ouvrir Gap: 5 et Extension Gap: 2 pénalités; Gap × débarquement: 50; Attendez-vous: 10; Parole Taille: 11; Filtre: sur.

Le pourcentage d’identité peut être mesurée sur la longueur d’une séquence définie entière, par exemple, tel qu’il est défini par un nombre particulier de SEQ ID N, ou peut être mesurée sur une longueur plus courte, par exemple, sur la longueur d’un fragment pris à partir d’une plus large, défini séquence, par exemple, un fragment d’au moins 20, au moins 30, au moins 40, au moins 50, au moins 70, au moins 100, ou au moins 200 nucléotides contigus. Ces longueurs sont que des exemples, et il est entendu que toute la longueur des fragments pris en charge par les séquences présentées ici, dans les tableaux, les figures, ou listage des séquences, peut être utilisé pour décrire une longueur sur laquelle le pourcentage d’identité peut être mesurée.

Les expressions « identité en pour cent» et «% d’identité», tel qu’il est appliqué à des séquences polypeptidiques, se réfèrent au pourcentage de résidus identiques correspondances entre au moins deux séquences polypeptidiques alignées en utilisant un algorithme standard. Les procédés d’alignement de séquences polypeptidiques sont bien connus. Des méthodes d’alignement de prendre en compte les substitutions conservatives d’acides aminés. De telles substitutions conservatives, expliqués plus en détail ci-dessus, généralement à préserver la charge hydrophobe et au niveau du site de substitution, afin de préserver la structure (et donc la fonction) du polypeptide. Les expressions «similarité pour cent » et « % de similarité », tel qu’il est appliqué à des séquences polypeptidiques, se réfèrent au pourcentage de correspondances de résidus, y compris les correspondances de résidus identiques et des substitutions conservatrices, entre au moins deux séquences polypeptidiques alignées en utilisant un algorithme standard. En revanche, les substitutions conservatrices ne sont pas inclus dans le calcul de l’identité en pour cent entre des séquences polypeptidiques.

Pour cent d’identité entre les séquences de polypeptides peut être déterminée en utilisant les paramètres de l’algorithme CLUSTAL V par défaut comme incorporé dans le programme d’alignement de séquence MEGALIGN version 3.12e (décrite et référencée ci-dessus). Pour les alignements par paires des séquences polypeptidiques utilisant CLUSTAL V, les paramètres par défaut sont définies comme suit: Ktuple = 1, pénalité de gap = 3, fenêtres = 5, et diagonales sauvegardées «  » = 5. La matrice PAM250 est sélectionné en tant que la table de résidu de poids par défaut.

Alternativement, la suite logicielle BLAST du NCBI peut être utilisé. Par exemple, pour une comparaison par paires de deux séquences polypeptidiques, on peut utiliser la «BLAST 2 Sequences » outil Version 2.0.12 (21 avril 2000) avec l’ensemble blastp à des paramètres par défaut. De tels paramètres par défaut peuvent être, par exemple: Matrice: BLOSUM62; Ouvrir Gap: 11 et Extension Gap: 1 pénalités; Gap × débarquement: 50; Attendez-vous: 10; Parole Taille: 3; Filtre: sur.

Le pourcentage d’identité peut être mesurée sur la longueur de la séquence polypeptidique définie entière, par exemple, tel qu’il est défini par un numéro SEQ ID particulier, ou peut être mesurée sur une longueur plus courte, par exemple, sur la longueur d’un fragment pris à partir d’un plus grand, séquence polypeptidique définie, par exemple, un fragment d’au moins 15, au moins 20, au moins 30, au moins 40, au moins 50, au moins 70 ou au moins 150 résidus contigus. Ces longueurs sont que des exemples, et il est entendu que toute la longueur des fragments pris en charge par les séquences présentées ici, dans les tableaux, figures ou listage des séquences, peut être utilisé pour décrire une longueur sur laquelle le pourcentage d’identité peut être mesurée.

Le terme «agent» englobe tout produit chimique, molécule biochimique ou biologique; tels que des petites molécules, des protéines, des polypeptides, des anticorps, des molécules d’acides nucléiques, y compris l’ADN ou de l’ARN et similaires.

Méthodes et compositions associés à l’inventive hEbola

La présente invention est basée sur l’isolement et l’identification d’une nouvelle espèce de virus Ebola humaines, EboBun et le séquençage de la seule autre connue Afrique de l’Ouest Ebola espèces EboIC. EboBun a été isolé à partir de patients souffrant de fièvre hémorragique dans une récente épidémie en Ouganda. Le virus isolé est un membre de la famille des Filoviridae, une famille de virus à ARN négatif de détection. En conséquence, l’invention concerne l’EboBun isolé ou d’un virus qui se rapporte EBOIC morphologiquement et phylogénétiquement de membres connus Filoviridae.

Dans un autre aspect, l’invention concerne un virus isolé hEbola comprenant une molécule d’acide nucléique avec une séquence nucléotidique qui est, de préférence: a) une séquence nucléotidique présentée dans SEQ ID NO: 1; b) une séquence nucléotidique qui s’hybride à la séquence présentée dans SEQ ID NO: 1 en vertu des conditions strictes; ou c) une séquence nucléotidique qui a au moins 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% d’identité avec la SEQ ID NO: 1 Dans. un mode de réalisation de la présente invention, le virus hEbola est tué. Dans un autre, le virus est atténué. Dans un autre, le pouvoir infectieux du virus atténué hEbola est réduite. Dans un autre, l’infectivité est réduite d’au moins 5 fois, 10 fois, 25 fois, 50 fois, 100 fois, 250 fois, 500 fois ou 10 000 fois. Dans une autre, la capacité de replication du virus atténué hEbola est réduite. Dans une autre, la capacité de replication du virus atténué est educed par au moins 5 fois, 10 fois, 25 fois, 50 fois, 100 fois, 250 fois, 500 fois, 1000 fois ou 10 000 – plier. Dans une autre, la capacité de synthèse de protéine du virus atténué est diminué. Dans une autre, la capacité de synthèse des protéines est réduite d’au moins 5 fois, 10 fois, 25 fois, 50 fois, 100 fois, 250 fois, 500 fois, 1000 fois ou 10 000 fois. Dans une autre, la capacité de l’assemblage du virus atténué hEbola est réduite. Dans une autre, la capacité de l’assemblage du virus atténué est réduite d’au moins 5 fois, 10 fois, 25 fois, 50 fois, 100 fois, 250 fois, 500 fois, 1000 fois ou 10 000 – plier. Dans un autre, l’effet cytopathique du virus atténué hEbola est réduite. Dans un autre, l’effet cytopathique est réduite d’au moins 5 fois, 10 fois, 25 fois, 50 fois, 100 fois, 250 fois, 500 fois, 1000 fois ou 10 000 fois.

Dans un autre aspect, l’invention fournit la séquence génomique complète du virus hEbola EboBun ou EboIC. Dans un mode de réalisation spécifique, le virus comprend une séquence nucléotidique de SEQ ID NO: 1 ou 10, respectivement.

Dans un aspect apparenté, l’invention fournit des molécules d’acide nucléique isolées à partir EboBun, EboIC, ou des fragments de ceux-ci. Dans un mode de réalisation de la présente invention, la molécule d’acide nucléique isolée comprend la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci. Dans une autre, la molécule d’acide nucléique comprend une séquence nucléotidique ayant au moins 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, ou 4900 nucleotides contigus de la séquence nucléotidique de SEQ ID NO: 1, ou un complément de celle-ci; avec la condition que la séquence nucléotidique ne soit pas comprise par la séquence nucléotidique présentée dans SEQ ID NO: 20 (séquence de nucléotides Ebola Zaïre); ou au moins 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, ou 6600 nucleotides contigus de la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci. Dans un autre mode de réalisation, la molécule d’acide nucléique isolée comprend une séquence nucléotidique qui code pour la séquence d’acides aminés EboBun de SEQ ID NOs: 2-9 ou 59, la séquence EboIC d’acides aminés de SEQ ID NO: 11 à 19, ou un complément de l’ séquence de nucléotides qui code pour les EboBun séquences d’acides aminés de SEQ ID NO: 2-9 ou 59 ou les séquences EboIC d’acides aminés de SEQ ID NO: 11-19. Dans une autre, la molécule d’acide nucléique isolé s’hybride dans des conditions stringentes à une molécule d’acide nucléique ayant la séquence de SEQ ID NOs nucléotidique: 1 ou 10 ou un complément de celui-ci, dans lequel la molécule d’acide nucléique code pour une séquence d’acides aminés qui a une activité biologique présentée par un polypeptide codé par la séquence nucléotidique de SEQ ID NO: 1. ou 10 Dans un autre, une molécule d’acide nucléique est un ARN. Dans une autre molécule d’acide nucléique est un ADN.

Dans un autre aspect, l’invention fournit des protéines ou des polypeptides qui sont isolés à partir de la EboBun, y compris les protéines virales isolées à partir de cellules infectées par le virus mais non présents dans les cellules non infectées comparables. Dans un mode de réalisation de la présente invention, les séquences d’acides aminés des protéines ou des polypeptides sont définies dans les SEQ ID NO: 2-9, 59, ou 11 à 19, ou des fragments de ceux-ci. Dans un mode de réalisation, les polypeptides ou protéines de la présente invention ont une activité biologique de la protéine (y compris l’antigénicité et / ou immunogénicité) codée par la séquence de SEQ ID NO: 1 ou 10 Dans un autre, les polypeptides ou les protéines de la présente. invention ont une activité biologique d’au moins une protéine ayant la séquence d’acides aminés (y compris l’antigénicité et / ou immunogénicité) présentée dans SEQ ID NOS: 2-9, 59, ou 11 à 19, ou un fragment de celui-ci.

Dans un aspect apparenté, l’invention fournit un polypeptide isolé codé par la molécule d’acide nucléique de l’invention décrite ci-dessus. Dans un mode de réalisation de la présente invention, le polypeptide isolé comprend la séquence d’acides aminés choisie dans le groupe constitué par: a) une séquence d’acides aminés présentée dans SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, ou 9; 11, 12, 13, 14, 15, 16, 17, 18 ou 19; et b) une séquence d’acides aminés qui a 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% ou 99% d’homologie avec la séquence d’acides aminés selon a). Dans un autre, le polypeptide isolé comprend la séquence d’acides aminés ayant au moins 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240 ou 250 résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 5 ou 18 (VP24); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 210, 220, 230, 240, 250, 260, 270, 280, contiguë les résidus d’acides aminés de la séquence d’acides aminés de SEQ ID NO: 6 ou 17 (VP30); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, ou 320 résidus d’acides aminés contigus de l’acide aminé séquence de SEQ ID NO: 8 ou 13 (VP40); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, ou 340 résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 7 ou 12 (VP35); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, ou 370 résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 4 ou 15 (PSC); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 310, 320, 330, 340, 350, 360, ou 370 résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 59 ou 16 (SSGP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 610, 620, 630, 640, 650, 660, ou 670 résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 9 ou 14 (GP); 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550, 600, 650, 700, 710, 720, ou 730 résidus d’acides aminés contigus de la séquence d’acides aminés de la SEQ ID N ° 3 ou 11 (NP); ou 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 450, 500, 550 , 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800 , 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2160, 2170, 2180, 2190, 2200 ou les résidus d’acides aminés contigus de la séquence d’acides aminés de SEQ ID NO: 2 ou 19 (L).

Dans d’autres aspects, l’invention concerne l’utilisation d’un virus isolé hEbola Afrique de l’Ouest pour les méthodes de diagnostic et thérapeutiques. Dans un mode de réalisation, l’invention fournit un procédé de détection dans un échantillon biologique d’un anticorps immunospécifique pour le virus hEbola utilisant le virus isolé hEbola inventive décrite ici, ou un quelconque des protéines ou polypeptides de l’invention tels que décrits ici. Dans un autre mode de réalisation spécifique, l’invention fournit un procédé de criblage d’un anticorps qui se lie de manière immunospécifique et neutralise hEbola EboBun ou EboIC ou une combinaison de ceux-ci. Un tel anticorps est utile pour une immunisation passive ou une immunothérapie d’un sujet infecté par le hEbola.

Dans un autre aspect, l’invention propose un anticorps isolé ou un fragment de liaison d’antigène de celui-ci qui se lie de manière immunospécifique à un virus du genre hEbola Afrique de l’Ouest de l’invention décrit ci-dessus, et notamment à titre d’illustration EboBun ou EboIC. Dans un mode de réalisation de la présente invention, l’anticorps isolé ou un fragment de liaison d’antigène de celui-ci neutralise un virus du genre hEbola Afrique de l’Ouest. Dans un autre, l’anticorps isolé ou un fragment de liaison d’antigène de celui-ci se lie de manière immunospécifique au polypeptide selon l’invention décrit ci-dessus. L’invention propose en outre des anticorps qui se lient spécifiquement à un polypeptide de l’invention codé par la séquence nucléotidique de SEQ ID NO: 1 (EboBun) ou 10 (EboIC), un fragment de celui-ci, ou codée par un acide nucléique comprenant une séquence nucléotidique qui s’hybride dans des des conditions stringentes à la séquence nucléotidique de SEQ ID NO: 1 (EboBun) ou 10 (EboIC) et / ou n’importe quel épitope hEbola EboBun, ayant une ou plusieurs activités biologiques d’un polypeptide de l’invention. Ces polypeptides comprennent ceux représentés dans les SEQ ID NO: 2-9, 59, et 11 à 19. De tels anticorps comprennent, mais ne sont pas limités à, des anticorps polyclonaux, monoclonaux, bispécifiques, multi-spécifiques, humains, des anticorps humanisés, chimériques, des anticorps monocaténaires, des fragments Fab, F (ab ‘) 2 fragments, à liaison disulfure des fragments Fv, anticorps intracellulaires et des fragments contenant un ou l’autre domaine VH ou VL, ou même une région de détermination de complémentarité (CDR) qui se lie spécifiquement à un polypeptide de l’invention.

Dans d’autres aspects, l’invention fournit des méthodes pour la détection de la présence, de l’activité ou de l’expression du virus hEbola de l’invention dans un matériau biologique, telles que les cellules, le sang, la salive, l’urine, et ainsi de suite. L’activité ou l’expression augmentée ou diminuée de la hEbola virus dans un échantillon par rapport à un échantillon témoin peuvent être déterminées en mettant en contact le matériau biologique avec un agent qui permet de détecter directement ou indirectement la présence, de l’activité ou de l’expression du virus hEbola. Dans un mode de réalisation de la présente invention, les agents de détection sont des anticorps ou des molécules d’acides nucléiques de la présente invention. Les anticorps de l’invention peuvent également être utilisés pour traiter la fièvre hémorragique.

Dans un aspect apparenté, l’invention fournit un procédé pour détecter la présence du virus de l’invention décrit ci-dessus hEbola dans un échantillon biologique, le procédé comprenant: (a) mettre en contact l’échantillon avec un agent qui se lie sélectivement au virus hEbola; et (b) détecter si le composé se lie au virus hEbola dans l’échantillon. Dans un mode de réalisation de la présente invention, l’échantillon biologique est choisi dans le groupe constitué de cellules; sang; sérum; plasma; fèces; rectaux, vaginaux et la conjonctive. Dans un autre, l’agent qui se lie au virus est un anticorps. Dans un autre, l’agent qui se lie au virus est une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou un complément de celle-ci. Dans un autre, l’agent qui se lie au virus est une molécule d’acide nucléique comprenant une séquence nucléotidique ayant au moins 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900, 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, ou 6600 nucléotides contigus de la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci.

Dans un autre aspect, l’invention fournit un procédé pour détecter la présence du polypeptide de l’invention décrit ci-dessus, dans un échantillon biologique, le procédé comprenant: (a) mettre en contact l’échantillon biologique avec un agent qui se lie sélectivement au polypeptide; et (b) détecter si l’agent se lie au polypeptide dans l’échantillon. Dans un mode de réalisation de la présente invention, l’échantillon biologique est choisi dans le groupe constitué de cellules; sang; sérum; plasma; fèces; rectaux, vaginaux et la conjonctive. Dans un autre, l’agent qui se lie au polypeptide est un anticorps ou un fragment de liaison d’antigène de celui-ci.

Dans un autre aspect, l’invention fournit un procédé pour détecter la présence d’une première molécule d’acide nucléique provenant du virus de l’invention hEbola décrit ci-dessus dans un échantillon biologique, le procédé comprend (a) la mise en contact de l’échantillon biologique avec un agent qui se lie sélectivement à l’ l’acide nucléique; et (b) détecter si l’agent se lie au nucléotide dans l’échantillon. Dans un mode de réalisation de la présente invention, l’agent qui se lie à la première molécule d’acide nucléique est une seconde molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou un complément de celle-ci. Dans une autre, la seconde molécule d’acide nucléique comprend au moins 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 , 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 4600, 4700, 4800, 4900 , 5000, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, ou 6600 nucleotides contigus de la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci.

Dans un autre aspect, l’invention fournit un procédé pour propager le virus hEbola dans des cellules hôtes comprenant l’infection des cellules hôtes avec un virus hEbola Afrique de l’Ouest inventive isolé décrit ci-dessus, mise en culture des cellules hôtes afin de permettre au virus de se multiplier, et la récolte des virions qui en résultent. Également fournis par la présente invention sont des cellules hôtes infectées par le virus de l’invention décrit ci-dessus hEbola. Dans un mode de réalisation de la présente invention, la cellule hôte est une cellule de primate.

Dans un autre aspect, l’invention fournit un procédé de détection dans un échantillon biologique la présence d’un anticorps qui se lie de manière immunospécifique hEbola virus, le procédé comprend: (a) mettre en contact l’échantillon biologique avec la cellule hôte selon l’invention décrit ci-dessus; et (b) la détection de l’anticorps lié à la cellule.

Dans un autre aspect, l’invention fournit des préparations de vaccins, y compris le virus de l’invention, y compris hEbola recombinant et des formes chimères de virus, des molécules d’acides nucléiques constituées par le virus, ou sous-unités protéiques du virus. Dans un mode de réalisation, les préparations vaccinales de la présente invention comprennent des virus vivants mais atténués hEbola avec ou sans supports pharmaceutiquement acceptables, y compris les adjuvants. Dans un autre, les préparations vaccinales de l’invention comprennent un virus inactivé ou tué hEbola EboBun, EboIC virus, ou une combinaison de ceux-ci, avec ou sans supports pharmaceutiquement acceptables, y compris les adjuvants. De tels virus atténués ou inactivés peuvent être préparés par une série de passages du virus dans les cellules hôtes ou en préparant les formes recombinantes ou chimères de virus. En conséquence, la présente invention propose en outre des procédés de préparation des formes recombinantes ou chimères de virus hEbola inventifs décrits ici.

Dans un autre mode de réalisation spécifique, l’invention fournit une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace du virus de l’invention hEbola décrit ci-dessus, et un support pharmaceutiquement acceptable. Dans une autre, la présente invention propose une formulation vaccinale comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’un extrait de protéine du virus de l’invention hEbola décrit ci-dessus, ou une sous-unité de celui-ci; et un support pharmaceutiquement acceptable. Dans un autre aspect, l’invention fournit une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans une autre, la présente invention propose une formulation vaccinale comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique selon l’invention comprenant l’un quelconque des séquences nucléotidiques telles que décrites ci-dessus, ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans un autre aspect, l’invention fournit une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’un extrait de protéine du virus de l’invention hEbola décrit ci-dessus, ou une sous-unité de celui-ci; et un support pharmaceutiquement acceptable. Dans un autre aspect, l’invention fournit une formulation de vaccin comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci, et un support pharmaceutiquement acceptable. Dans une autre, la présente invention propose une formulation vaccinale comprenant une quantité thérapeutiquement ou prophylactiquement efficace d’une molécule d’acide nucléique selon l’invention comprenant l’un quelconque des séquences nucléotidiques telles que décrites ci-dessus, ou un complément de celle-ci, et un support pharmaceutiquement acceptable.

Dans encore un autre mode de réalisation spécifique, les préparations vaccinales de la présente invention comprennent un acide nucléique ou d’un fragment de virus hEbola, par exemple, le virus ayant le numéro d’accès 200706291, ou molécules d’acide nucléique ayant la séquence de SEQ ID NO: 1 ou 10, ou un fragment de celui-ci. Dans un autre, les préparations de vaccins comprennent un polypeptide de l’invention codé par la séquence nucléotidique de SEQ ID NO: 1 ou 10 ou un fragment de celui-ci. Dans un mode de réalisation spécifique, les préparations de vaccins comprennent des polypeptides de l’invention telle que représentée dans la SEQ ID NO: 2-9, 59, ou 11 à 19, ou codé par la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un fragment de celui-ci .

En outre, la présente invention propose des procédés pour traiter, améliorer, la gestion ou la prévention de la fièvre hémorragique par administration des préparations de vaccins ou anticorps de seul ou en combinaison avec des adjuvants, ou d’autres excipients pharmaceutiquement acceptables de la présente invention. En outre, la présente invention propose des procédés pour traiter, améliorer, la gestion ou la prévention de la fièvre hémorragique par administration des compositions de l’invention et les formulations, y compris les préparations de vaccins ou des anticorps de la présente invention seul ou en combinaison avec des antiviraux [par exemple, l’amantadine, la rimantadine, le ganciclovir, acyclovir, ribavirine, penciclovir, l’oseltamivir, la zidovudine foscarnet (AZT), didanosine (ddI), lamivudine (3TC), zalcitabine (ddC), stavudine (d4T), la névirapine, la delavirdine, l’indinavir, le ritonavir, la vidarabine, le nelfinavir, le saquinavir, le Relenza, tamiflu, pléconaril, les interférons, etc], des stéroïdes et des corticostéroïdes tels que la prednisone, la cortisone, la fluticasone et de glucocorticoïdes, les antibiotiques, les analgésiques, les bronchodilatateurs, ou d’autres traitements pour les infections respiratoires et / ou virales.

Dans un aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace du virus de l’invention hEbola décrit ci-dessus, et un support pharmaceutiquement acceptable.

Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’un extrait de protéine du virus de l’invention décrit ci-dessus hEbola ou une sous-unité de celui-ci, et un support pharmaceutiquement acceptable.

Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1, 10, d’une combinaison de ceux-ci, ou un complément de celle-ci, et un support pharmaceutiquement acceptable.

Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’une molécule d’acide nucléique comprenant la séquence nucléotidique selon l’invention tel que décrit ci-dessus ou un complément de celle-ci, et un support pharmaceutiquement acceptable.

Dans un autre aspect apparenté, l’invention fournit une formulation immunogène comprenant une quantité immunogéniquement efficace d’un quelconque des polypeptides de l’invention décrites ci-dessus.

Dans un autre aspect, la présente invention propose des compositions pharmaceutiques comprenant des agents antiviraux de la présente invention et un support pharmaceutiquement acceptable. Dans un mode de réalisation spécifique, l’agent antiviral de l’invention est un anticorps qui se lie de manière immunospécifique hEbola virus ou tout épitope hEbola. Dans un autre mode de réalisation spécifique, l’agent antiviral est un polypeptide ou une protéine de la présente invention ou d’une molécule d’acide nucléique de l’invention.

Dans un aspect apparenté, l’invention fournit une composition pharmaceutique comprenant une quantité prophylactiquement ou thérapeutiquement efficace d’un agent anti-hEbola EboBun et un support pharmaceutiquement acceptable. Dans un mode de réalisation de la présente invention, l’agent anti-hEbola EboBun est un anticorps ou un fragment de liaison d’antigène de celui-ci qui se lie de manière immunospécifique au virus hEbola de dépôt Accession n ° 200706291, ou des polypeptides ou des protéines qui en sont dérivés. Dans un autre, l’agent anti-hEbola est une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1, 10, d’une combinaison de ceux-ci, ou un fragment de celui-ci. Dans un autre, l’agent anti-hEbola est un polypeptide codé par une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1, 10, d’une combinaison de ceux-ci, ou un fragment de celui-ci ayant une activité biologique du polypeptide.

L’invention fournit également des trousses contenant des compositions et des formulations de la présente invention. Ainsi, dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la formulation immunogène de l’invention décrit ci-dessus.

Dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la formulation de vaccin selon l’invention décrit ci-dessus.

Dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la composition pharmaceutique selon l’invention décrit ci-dessus.

Dans un autre aspect, l’invention fournit un kit comprenant un récipient contenant la formulation de vaccin selon l’invention décrit ci-dessus.

Dans un autre aspect, l’invention fournit un procédé d’identification d’un sujet infecté par le virus de l’invention hEbola décrit ci-dessus, y compris: (a) obtenir l’ARN total à partir d’un échantillon biologique obtenu à partir du sujet; (B) la transcription inverse de l’ARN total pour obtenir l’ADNc; et (c) l’amplification de l’ADNc en utilisant un ensemble d’amorces dérivées de la séquence nucléotidique du virus hEbola inventif décrit ci-dessus.

Dans un mode de réalisation de la présente invention, le jeu d’amorces sont dérivées de la séquence nucléotidique du génome du virus hEbola de dépôt Accession n ° 200706291 Dans un autre, le jeu d’amorces sont dérivées de la séquence nucléotidique de SEQ ID NO.: 1 ou 10 ou n’importe laquelle des séquences nucléotidiques selon l’invention tel que décrit ci-dessus, ou un de ses compléments.

L’invention concerne en outre l’utilisation des informations de séquence du virus isolé pour des méthodes diagnostiques et thérapeutiques. Dans un mode de réalisation spécifique, l’invention fournit des molécules d’acides nucléiques qui sont appropriés pour être utilisés comme amorces consistant en ou comprenant la séquence nucléotidique de SEQ ID NO: 1 ou 10, ou un complément de celle-ci, ou au moins une partie de la séquence nucléotidique de celui-ci. Dans un autre mode de réalisation spécifique, l’invention fournit des molécules d’acides nucléiques qui sont appropriés pour l’hybridation à l’acide nucléique de l’invention hEbola; y compris, mais sans s’y limiter, les amorces de PCR, Reverse amorces de transcriptase, des sondes pour l’analyse de Southern ou une autre analyse d’hybridation d’acide nucléique pour la détection de hEbola acides nucléiques, par exemple, à base de ou incluant la séquence de nucléotides de SEQ ID NO: 1, 10 d’une combinaison de celui-ci, un de ceux-ci du complément, ou une partie de celui-ci. L’invention englobe en outre des virus chimères ou recombinants codés en totalité ou en partie par les séquences nucléotidiques.

Dans un autre aspect, la présente invention propose des procédés pour le criblage d’agents antiviraux qui inhibent la replication ou l’infectivité des virus hEbola ou variants de ceux-ci.

L’invention propose en outre des procédés de préparation des formes recombinantes ou chimériques de hEbola.

Dans un autre aspect, l’invention fournit des préparations de vaccins, y compris le virus hEbola, y compris des formes recombinantes et chimères de virus, ou de sous-unités du virus. La présente invention concerne des virus recombinants ou chimères codées par des vecteurs viraux dérivés du génome du virus selon l’invention décrite ici hEbola ou des variants naturels de celle-ci. Dans un mode de réalisation spécifique, un virus recombinant est un dérivé du virus de hEbola Dépôt d’adhésion N ° 200706291. Il est reconnu que des variants naturels des virus hEbola inventifs décrits ici comprennent une ou plusieurs mutations, y compris, mais sans s’y limiter, des mutations ponctuelles , des réarrangements, des insertions, délétions, etc, à la séquence génomique. Il est reconnu que les mutations peuvent ou non se traduire par un changement phénotypique.

Dans un autre mode de réalisation spécifique, un virus chimère de l’invention est un virus recombinant ou hEbola EboBun EboIC qui comprend en outre une séquence nucléotidique hétérologue. Conformément à l’invention, un virus chimère peut être codée par une séquence nucléotidique dans laquelle des séquences de nucleotides hétérologues ont été ajoutés au génome ou dans lequel les séquences nucléotidiques endogènes ou natifs ont été remplacées par des séquences nucléotidiques hétérologues.

Selon la présente invention, les virus chimériques sont codées par des vecteurs viraux de l’invention qui comprennent en outre une séquence nucléotidique hétérologue. Conformément à la présente invention, un virus chimérique est codée par un vecteur viral qui peuvent ou peuvent ne pas comprendre des acides nucléiques qui sont non-natif au génome viral. Conformément à l’invention, un virus chimérique est codée par un vecteur viral dans laquelle les séquences de nucléotides hétérologues ont été ajoutés, insérés ou substitués pour les séquences natives ou non natives. Conformément à la présente invention, le virus chimérique peut être codé par des séquences nucléotidiques dérivées de différentes espèces ou variantes de virus hEbola. En particulier, le virus chimérique est codée par des séquences nucléotidiques qui codent pour des polypeptides antigéniques provenant de différentes espèces ou des variants de virus hEbola.

Un virus chimère peut être particulièrement utile pour la production de vaccins recombinants protégeant contre deux ou plusieurs virus (Tao et al, J. Virol 72, 2955-2961;… Durbin et al, 2000, J. Virol 74, 6821. -6831; Skiadopoulos et al, 1998, J. Virol 72, 1762-1768 (1998);… Teng et al, 2000, J. Virol 74, 9317-9321).. Par exemple, il peut être envisagé qu’un vecteur viral dérivé du virus hEbola exprimant une ou plusieurs protéines de variantes de virus hEbola y compris hEbola EboBun, ou vice versa, permettra de protéger un sujet vacciné avec un tel vecteur contre les infections à la fois par la hEbola natif et la variante. Virus atténués et la réplication et peuvent être utiles à des fins de vaccination avec les vaccins vivants comme cela a été suggéré pour d’autres virus. (Voir, par exemple, PCT WO 02/057302, p 6 et 23, et aux États-Unis la demande de brevet Publication 2008/0069838 incorporé ici par référence).

Conformément à la présente invention, la séquence hétérologue à être incorporés dans les vecteurs viraux codant pour les virus recombinants ou chimères de l’invention comprennent des séquences issues ou dérivées de différentes espèces ou variantes de hEbola.

Dans certains modes de réalisation, les virus chimères ou recombinants de l’invention sont codés par des vecteurs viraux dérivés des génomes viraux dans lequel une ou plusieurs séquences, des régions intergéniques, des séquences termini, ou des parties ou l’ensemble de l’ORF ont été substitués par une séquence hétérologue ou non-natif. Dans certains modes de réalisation de l’invention, les virus chimériques de l’invention sont codés par des vecteurs viraux dérivés des génomes viraux dans lequel une ou plusieurs séquences hétérologues ont été insérées ou ajoutées au vecteur.

Le choix du vecteur viral peut dépendre de l’espèce de l’objet qui doit être traité ou protégé d’une infection virale. Si le sujet est un être humain, puis d’un virus atténué hEbola peut être utilisé pour fournir les séquences antigéniques.

Conformément à la présente invention, les vecteurs viraux peuvent être conçus pour fournir des séquences antigéniques qui confèrent une protection contre une infection par le hEbola l’invention et des variantes naturelles de ceux-ci. Les vecteurs viraux peuvent être conçus pour fournir une, deux, trois ou plusieurs séquences antigéniques. Conformément à la présente invention, les séquences antigéniques peuvent être dérivées à partir du même virus, à partir de différentes espèces ou des variantes d’un même type de virus ou de virus différents.

Les produits et / ou recombinant ou d’expression des virions chimères obtenus conformément à l’invention peuvent avantageusement être utilisés dans des formulations de vaccins. Les produits d’expression et des virions chimères de la présente invention peuvent être modifiés pour créer des vaccins contre une grande variété d’agents pathogènes, y compris les antigènes viraux et bactériens, des antigènes tumoraux, des antigènes, des allergènes et des antigènes auto impliqués dans les troubles auto-immuns. Une façon d’atteindre cet objectif consiste à modifier les gènes de hEbola existants pour contenir des séquences étrangères dans leurs domaines externes respectifs. Où les séquences hétérologues sont des epitopes ou antigènes de pathogènes, ces virus chimériques peuvent être utilisés pour induire une réponse immunitaire protectrice contre l’agent pathogène à partir duquel ces déterminants sont dérivés. En particulier, les virions chimères de la présente invention peuvent être modifiés pour créer des vaccins pour la protection d’un sujet contre les infections par le virus hEbola et des variants de ceux-ci.

Ainsi, la présente invention concerne en outre l’utilisation de vecteurs viraux et virus recombinants chimériques ou de formuler des vaccins contre un large éventail de virus et / ou des antigènes. La présente invention englobe également des virus recombinants, y compris un vecteur viral dérivé du hEbola ou des variantes de celui-ci qui contient des séquences qui aboutissent à un virus ayant un phénotype plus approprié pour une utilisation dans des formulations de vaccins, par exemple, un phénotype atténué ou une antigénicité accrue. Les mutations et modifications peuvent être dans des régions codantes, dans les régions intergéniques et dans les tête et de queue séquences du virus.

L’invention fournit une cellule hôte comprenant un acide nucléique ou un vecteur selon l’invention. Plasmide ou viraux vecteurs contenant les composants de la polymérase du virus hEbola sont générés dans des cellules procaryotes pour l’expression des composants de types de cellules pertinents (bactéries, des cellules d’insecte, des cellules eucaryotes). Plasmide ou viraux contenant des vecteurs de longueur complète ou partielle des copies du génome hEbola seront générés dans des cellules procaryotes pour l’expression des acides nucléiques viraux in vitro ou in vivo. Ces derniers vecteurs contiennent éventuellement d’autres séquences virales pour la génération de virus chimères ou protéines de virus chimériques, des pièces de manque éventuellement du génome viral pour la génération de la réplication du virus défectueux, et facultativement contiennent des mutations, deletions ou insertions pour la génération de virus atténués. En outre, la présente invention fournit une cellule hôte infectée par le virus de hEbola fort Accession n ° 200706291,

Copies infectieuses de hEbola Afrique de l’Ouest (étant de type sauvage, atténuée, la réplication défectueuse ou chimère) sont éventuellement produites lors de la co-expression des composantes de la polymérase en fonction des technologies à la pointe de la technologie décrits ci-dessus.

En outre, des cellules eucaryotes, exprimant de manière transitoire ou de manière stable un ou plusieurs de pleine longueur ou partielles des protéines hEbola sont éventuellement utilisés. Ces cellules sont de préférence réalisés par transfection (protéines ou des vecteurs d’acide nucléique), infection (vecteurs viraux) ou des vecteurs viraux (transduction) et sont utiles pour la complémentation de type sauvage mentionné, atténués, des virus défectifs pour la replication ou chimérique.

Les vecteurs viraux et des virus chimères de la présente invention modulent facultativement système immunitaire d’un sujet par stimulation d’une réponse immunitaire humorale, une réponse immunitaire cellulaire ou par la stimulation de la tolérance à un antigène. Tel qu’utilisé ici, signifie un sujet: les êtres humains, les primates, les chevaux, les vaches, les moutons, les porcs, les chèvres, les chiens, les chats, les espèces aviaires et des rongeurs.

Formulation de vaccins et d’antiviraux

Dans un mode de réalisation préféré, l’invention fournit une molécule protéique ou une protéine virale spécifique du virus hEbola ou un fragment fonctionnel de celui-ci codé par un acide nucléique selon l’invention. Molécules protéiniques utiles sont par exemple dérivées d’un quelconque des gènes ou des fragments génomiques pouvant être dérivés à partir du virus selon l’invention, de préférence, le GP, L, NP, PSC, VP24, VP30, VP35, et VP 40 protéines décrits dans ce document. Ces molécules, ou des fragments antigéniques de ceux-ci, comme prévu ici, sont par exemple utiles dans des méthodes de diagnostic ou des kits et des compositions pharmaceutiques tels que les vaccins sous-unitaires. Particulièrement utiles sont les polypeptides codés par la séquence nucléotidique de SEQ ID NO: 1 ou 10; ou des fragments antigéniques de ceux-ci pour l’inclusion en tant que sous-unité immunogène ou antigène, mais le virus entier inactivé peuvent aussi être utilisés. Particulièrement utiles sont également les substances protéiques qui sont codés par les fragments d’acides nucléiques recombinants du génome hEbola, bien entendu préférés sont ceux qui sont dans les limites et les tenants préférés des ORF, en particulier, pour induire un anticorps spécifique hEbola ou réponses des cellules T, soit in vivo (par exemple, à des fins de protection ou thérapeutiques ou de diagnostic pour fournir des anticorps) ou in vitro (par exemple par la technologie de présentation sur phage ou une autre technique utile pour générer des anticorps synthétiques).

Il est reconnu que de nombreuses variantes, des analogues ou des homologues de polypeptides EboBun sont dans la portée de la présente invention comprenant des substitutions d’acides aminés, des altérations, des modifications, ou d’autres changements d’acides aminés qui augmenter, diminuer ou ne modifie pas la fonction ou la propension immunogène de l’immunogène inventive ou vaccin. Plusieurs modifications post-traductionnelles sont de même envisagés dans la portée de la présente invention, y compris à titre d’exemple l’incorporation d’un acide aminé d’origine non naturelle (s), la phosphorylation, la glycosylation, la sulfatation et l’addition de groupes pendants tels que biotynlation, fluorophores, lumiphores, les groupes radioactifs, des antigènes, ou d’autres molécules.

Méthodes d’expression et la purification de peptides naturels ou recombinants et des protéines sont bien connus dans l’art. A titre d’exemple, les peptides et les protéines sont exprimées de manière recombinante dans des cellules eucaryotes. Des exemples de cellules eucaryotes comprennent les levures, les cellules HeLa, les cellules 293, des cellules COS, des cellules d’ovaire de hamster chinois (CHO), et de nombreux autres types de cellules connues dans l’art. Les deux systèmes d’expression et des cellules eucaryotes et procaryotes sont disponibles auprès d’Invitrogen Corp illustrative, Carlsbad, CA Il est apprécié que les systèmes d’expression acellulaires sont pareillement être mis en oeuvre.

Dans un mode de réalisation préféré, un polypeptide immunogène est une protéine de pleine longueur de EboBun. De préférence, un agent immunogène est une protéine pleine longueur de EboBun de la SEQ ID N ° 2-9 ou 59, ou EboIC SEQ ID NO: 11-19, ou un fragment de celui-ci tel que décrit ici. De préférence, un immunogène est a un minimum de 5 acides aminés. Tel qu’utilisé ici, un immunogène est de préférence un polypeptide. Dans le contexte d’un polypeptide immunogène les termes immunogène, un polypeptide, et l’antigène sont utilisés de manière interchangeable.

Des modifications et des changements peuvent être apportés à la structure des immunogènes selon l’invention qui font l’objet de la requête et obtenir encore une molécule ayant des caractéristiques similaires ou améliorées comme la séquence de type sauvage (par exemple, une substitution d’acide aminé conservatrice). Par exemple, certains acides aminés sont éventuellement substitués par d’autres acides aminés dans une séquence sans perte appréciable d’activité immunogène. Étant donné que c’est la capacité interactive et la nature d’un polypeptide qui définissent l’activité fonctionnelle biologique de polypeptide, certaines substitutions de séquences d’acides aminés peut être effectuée dans une séquence de polypeptide et néanmoins obtenir un polypeptide ayant des propriétés similaires ou améliorées. Eventuellement, un polypeptide est utilisé qui a une activité plus ou moins immunogène par rapport à la séquence de type sauvage.

En effectuant de tels changements, l’indice hydropathique des acides aminés est de préférence pris en compte. L’importance de l’indice d’acide aminé hydropathique dans conférer une fonction biologique interactive sur un polypeptide est généralement comprise dans la technique. Il est connu que certains acides aminés peuvent être substitués à d’autres acides aminés ayant un indice ou score hydropathique similaire et encore donner lieu à un polypeptide ayant une activité biologique similaire. Chaque acide aminé s’est vu attribuer un indice hydropathique sur la base de ses caractéristiques d’hydrophobicité et de charge. Ces indices sont: isoleucine (+4,5); valine (4,2); leucine (3,8); phénylalanine (2,8); cysteine ​​/ cystéine (2,5); méthionine (1,9); alanine (1,8); glycine (-0,4); thréonine (-0,7); serine (-0,8); tryptophane (-0,9); tyrosine (-1,3); proline (-1,6); histidine (-3,2); glutamate (-3,5); glutamine (-3,5); aspartate (-3,5); asparagine (-3,5); lysine (-3,9); et arginine (-4,5).

On pense que le caractère hydropathique relatif de l’acide aminé détermine la structure secondaire du polypeptide résultant, qui à son tour définit l’interaction du polypeptide avec d’autres molécules, telles que des enzymes, des substrats, des récepteurs, des anticorps, des antigènes, et analogues. Il est connu dans l’art qu’un acide aminé peut être substitué par un autre acide aminé ayant un index hydropathique similaire et encore obtenir un immunogène fonctionnellement équivalent. Dans de tels changements, la substitution d’acides aminés dont les indices hydropathiques sont à ± 2 est préférée, ceux à l’intérieur de ± 1 sont particulièrement préférés, et ceux à l’intérieur de ± 0,5 sont encore plus particulièrement préférés.

Comme indiqué ci-dessus, les substitutions d’acides aminés sont généralement basées sur la similarité relative des substituants de chaîne latérale d’acide aminé, par exemple, leur hydrophobie, hydrophilie, charge, taille, et analogues. Des exemples de substitutions qui prennent diverses des caractéristiques précédentes en considération sont bien connus de l’homme de l’art et comprennent (résidu original: substitution exemplaire): (Ala: Gly, Ser), (Arg: Lys), (Asn: Gin, Sa), (Asp: Glu, Cys, Ser), (Gin: Asn), (Glu: Asp), (Gly: Ala), (Son: Asn, Gln), (Ile: Leu, Val), (Leu: Ile, Val), (Lys: Arg), (Met: Leu, Tyr), (Ser: Thr), (Thr Ser), (Astuce: Tyr), (Tyr: Trp, Phe), et (Val: Ile , Leu). Des modes de réalisation de la présente description prévoient donc des équivalents fonctionnels ou biologiques d’un polypeptide immunogène et comme exposé ci-dessus. En particulier, les modes de réalisation des polypeptides immunogènes et comprennent éventuellement des variants ayant environ 50%, 60%, 70%, 80%, 90%, et une identité de séquence de 95% avec le polypeptide d’intérêt.

L’invention propose des formulations de vaccins pour la prévention et le traitement des infections par le virus hEbola. Dans certains modes de réalisation, le vaccin de l’invention comprend des virus recombinants chimériques et du virus hEbola. Dans certains modes de réalisation, le virus est atténué.

Dans un autre mode de réalisation de cet aspect de l’invention, des formulations de vaccins inactivés sont préparés en utilisant des techniques classiques pour «tuer» les virus chimériques. Les vaccins inactivés sont «morts» dans le sens où leur infectivité a été détruite. Idéalement, le pouvoir infectieux du virus est détruite sans affecter son immunogénicité. Afin de préparer des vaccins inactivés, le virus chimère peut être cultivé dans une culture cellulaire ou dans l’allantoïde de l’embryon de poulet, purifié par ultracentrifugation zonale, inactivé par le formaldéhyde ou la β-propiolactone, et mis en commun. Le vaccin obtenu est habituellement inoculé par voie intramusculaire ou intranasale.

Les virus inactivés sont éventuellement formulés avec un adjuvant approprié pour augmenter la réponse immunologique. Ces adjuvants comprennent, mais à titre d’exemple ne sont pas limités à des gels minéraux, par exemple, l’hydroxyde d’aluminium; des substances tensioactives telles que la lysolécithine, des polyols Pluronic, des polyanions; peptides; émulsions d’huile; et des adjuvants humains potentiellement utiles tels que BCG etCorynebacterium parvum.

Dans un autre aspect, la présente invention propose également des formulations de vaccins à ADN, y compris un acide nucléique ou d’un fragment de virus selon l’invention hEbola, par exemple, le virus ayant le numéro d’accès 200706291, ou molécules d’acide nucléique ayant la séquence de SEQ ID NO: 1 ou 10, ou un fragment de celui-ci. Dans un autre mode de réalisation particulier, les formulations de vaccins à ADN de la présente invention comprennent un acide nucléique ou un fragment de celle-ci codant pour les anticorps qui se lient de manière immunospécifique hEbola virus. Dans des formulations de vaccins à ADN, un ADN vaccin comprend un vecteur viral, tel que celui dérivé du virus hEbola, plasmide bactérien ou d’un autre vecteur d’expression, portant un insert comprenant une molécule d’acide nucléique de la présente invention liée de manière fonctionnelle à un ou plusieurs éléments de contrôle , ce qui permet l’expression des protéines codées par la vaccination de la molécule d’acide nucléique chez un sujet vacciné. De tels vecteurs peuvent être préparés par la technologie d’ADN recombinant en tant que vecteurs viraux recombinants chimériques ou portant une molécule d’acide nucléique de la présente invention.

Un acide nucléique tel qu’il est utilisé ici se réfère à des molécules simple brin ou double brin, qui sont de l’ADN, éventuellement, y compris les bases de nucléotides A, T, C et G, ou d’ARN, y compris les bases A, U (succédanés de T), C, et G. L’acide nucléique peut représenter un brin codant ou son complément. Les acides nucléiques sont éventuellement séquence identique à la séquence qui se produit naturellement ou comprennent d’autres codons qui codent pour le même acide aminé que celui qui se trouve dans la séquence d’origine naturelle. En outre, les acides nucléiques comprennent éventuellement des codons qui représentent des substitutions conservatrices d’acides aminés qui sont bien connus dans la technique.

Tel qu’il est utilisé ici, le terme «acide nucléique isolé» désigne un acide nucléique séparé ou substantiellement exempt d’au moins une partie des autres composants de l’organisme d’origine naturelle, par exemple, les éléments de structure de cellules généralement trouvés associés à des acides nucléiques dans un environnement cellulaire et / ou d’autres acides nucléiques. L’isolement des acides nucléiques est de manière illustrative accomplie par des techniques telles que la lyse des cellules suivie de phénol ainsi une extraction au chloroforme suivies d’une précipitation à l’éthanol des acides nucléiques. Les acides nucléiques de la présente invention sont isolées à partir de cellules à titre d’exemple selon des procédés bien connus dans l’art pour isoler des acides nucléiques. En variante, les acides nucléiques de la présente invention sont éventuellement synthétisés selon des protocoles standard bien décrites dans la littérature pour la synthèse des acides nucléiques. Les modifications des acides nucléiques de l’invention sont également envisagés, à condition que la structure fondamentale et la fonction du peptide ou polypeptide codé par l’acide nucléique sont maintenues.

L’acide nucléique codant pour le peptide ou polypeptide de la présente invention est éventuellement une partie d’un produit d’assemblage d’acide nucléique recombinant comprenant n’importe quelle combinaison de sites de restriction et / ou des éléments fonctionnels qui sont bien connus dans la technique, qui facilitent le clonage moléculaire et d’autres manipulations d’ADN recombinant. Ainsi, la présente invention propose en outre un produit d’assemblage d’acide nucléique recombinant comprenant un acide nucléique codant pour un polypeptide de la présente invention.

En général, il peut être plus commode d’employer comme le polynucléotide recombinant d’une version d’ADNc du polynucléotide. On pense que l’utilisation d’une version d’ADNc offrira des avantages en ce que la taille du gène sera généralement beaucoup plus petits et plus facilement utilisé pour transfecter la cellule cible que ne le ferait un gène génomique, qui sera typiquement jusqu’à un ordre de grandeur plus grand que le gène d’ADNc. Toutefois, l’inventeur n’exclut pas la possibilité d’employer une version génomique d’un gène particulier, lorsque cela est désiré.

Tel qu’il est utilisé ici, les termes «conçues» et des cellules «recombinants» sont synonymes avec les cellules « hôtes » et sont destinés à faire référence à une cellule dans laquelle un segment d’ADN exogène ou d’un gène, tel qu’un ADNc ou un gène a été introduit. Par conséquent, les cellules modifiées peuvent être distinguées des cellules qui ne contiennent pas de gène ou un segment d’ADN exogène introduit de manière recombinante d’origine naturelle. Une cellule hôte est éventuellement une cellule d’origine naturelle qui est transformé avec un segment d’ADN exogène ou d’un gène ou d’une cellule qui n’est pas modifiée. Une cellule hôte de préférence ne possède pas un gène naturel codant pour la protéine G du VRS. Les cellules modifiées sont, par conséquent, des cellules ayant un gène ou des gènes introduits par la main de l’homme. Les cellules recombinantes comprennent à titre d’exemple ceux ayant un ADNc introduit ou un ADN génomique, et comprennent également des gènes positionnés de manière adjacente à un promoteur non naturellement associé au gène introduit particulier.

Pour exprimer un polypeptide codé recombinant conforme à la présente invention, on prépare éventuellement un vecteur d’expression qui comprend un polynucleotide sous le contrôle d’un ou plusieurs promoteurs. Pour amener une séquence codante « sous le contrôle d ‘ » un promoteur, on positionne l’extrémité du site d’initiation de traduction du cadre de lecture en général comprise entre environ 1 et 50 nucleotides « en aval » de (à savoir, 3’) du promoteur choisi 5 . Le promoteur «en amont» stimule la transcription de l’ADN inséré et favorise l’expression de la protéine recombinante codée. Ceci est la signification d ‘«expression recombinante» dans le contexte utilisé ici.

De nombreuses techniques standard sont disponibles pour construire des vecteurs d’expression contenant les acides nucléiques appropriés et les séquences de contrôle transcriptionnel / traductionnel afin d’obtenir la protéine ou de l’expression d’un peptide dans une variété de systèmes d’expression hôte. types disponibles pour l’expression de cellules comprennent, mais ne sont pas limités à, les bactéries, telles que E. coli et B. subtilis transformées avec l’ADN de phage recombinant, l’ADN de plasmide ou de cosmide des vecteurs d’expression d’ADN.

Certains exemples d’hôtes procaryotes comprennent à titre d’exemple E. colisouche RR1, E. coli LE392, E. coli B, E. coli 1776 (ATCC n ° 31537) ainsi que E. coliW3110 (F-, lambda-, prototrophe, ATCC n ° 273325); des bacilles tels queBacillus subtilis ; et d’autres entérobactéries telles que Salmonella typhimurium, Serratia marcescens , et divers Pseudomonas espèces.

En général, les vecteurs plasmidiques contenant un réplicon et des séquences de contrôle qui sont dérivées d’espèces compatibles avec la cellule hôte sont utilisés en rapport avec ces hôtes. Le vecteur porte habituellement un site de replication, ainsi que des séquences qui sont capables de fournir une sélection phénotypique dans les cellules transformées de marquage. Par exemple, E. coliest souvent transformée en utilisant pBR322, un plasmide dérivé d’un E. coliespèces. Le plasmide pBR322 contient des gènes pour la résistance à l’ampicilline et à la tetracycline et fournit un moyen aisé pour identifier les cellules transformées. Le plasmide pBR322, ou un autre plasmide microbien ou phage peuvent également contenir, ou être modifié pour contenir, des promoteurs qui peuvent être utilisés par l’organisme microbien pour l’expression de ses propres protéines.

En outre, les vecteurs phagiques contenant un réplicon et des séquences de contrôle qui sont compatibles avec le microorganisme hôte sont éventuellement utilisées en tant que vecteurs de transformation en connexion avec ces hôtes. Par exemple, le phage lambda est éventuellement utilisé dans la fabrication d’un vecteur phage recombinant qui peut être utilisé pour transformer des cellules hôtes, telles que E. coli LE392.

En outre des vecteurs utiles comprennent les vecteurs pIN et les vecteurs pGEX, pour une utilisation dans la génération de la glutathion-S-transférase (GST) des protéines de fusion soluble pour la purification et la séparation ou clivage ultérieur. D’autres protéines de fusion appropriées sont celles avec des β-galactosidase, ubiquitine, ou similaire.

Les promoteurs qui sont les plus couramment utilisés dans la construction d’ADN recombinant comprennent la β-lactamase (penicillinase), du lactose et du tryptophane (trp) systèmes de promoteur. Alors que ceux-ci sont, d’autres promoteurs les plus couramment utilisés microbiens ont été découverts et utilisés, et les détails concernant leurs séquences de nucleotides ont été publiées, permettant à l’homme de l’art de les ligaturer fonctionnellement à des vecteurs plasmidiques.

Pour l’expression dans Saccharomyces , le plasmide YRp7, par exemple, est couramment utilisé. Ce plasmide contient le gène TRP1, qui fournit un marqueur de sélection pour une souche mutante de levure dépourvue de l’aptitude à croître dans le tryptophane, par exemple ATCC N ° 44076 ou PEP4-1. La présence de la lésion de trp1 en tant que caractéristique du génome de la cellule hôte de levure fournit alors un environnement efficace pour détecter la transformation par croissance en l’absence de tryptophane.

Des séquences promotrices appropriées dans les vecteurs de levure comprennent à titre d’exemple les promoteurs pour la 3-phosphoglycérate kinase ou d’autres enzymes glycolytiques, comme l’énolase, la glycéraldéhyde-3-phosphate déshydrogénase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomérase, 3-phosphoglycérate mutase, pyruvate kinase, triosephosphate isomérase, la phosphoglucose-isomérase et la glucokinase. Dans la construction de plasmides d’expression appropriés, les séquences de terminaison associées à ces gènes sont également de préférence ligaturées dans le vecteur d’expression 3 ‘de la séquence souhaitée pour être exprimées pour fournir une polyadénylation de l’ARNm et la terminaison.

D’autres promoteurs appropriés, qui ont l’avantage supplémentaire d’une transcription contrôlée par les conditions de croissance, comprennent à titre d’exemple la région de promoteur pour l’alcool déshydrogénase 2, l’isocytochrome C, la phosphatase acide, les enzymes de dégradation associées au métabolisme de l’azote, et la glycéraldéhyde-3-phosphate précité déshydrogénase, et enzymes responsables de l’utilisation du maltose et du galactose.

En plus de micro-organismes, des cultures de cellules dérivées d’organismes multicellulaires sont également fonctionner comme hôtes. En principe, n’importe quelle culture de cellules peut fonctionner de façon telle, qu’il s’agisse de vertébrés ou d’invertébrés culture. En plus des cellules de mammifères, celles-ci comprennent des systèmes de cellules d’insectes infectés avec des vecteurs d’expression de virus recombinant (par exemple, baculovirus); et des systèmes de cellules végétales infectées avec des vecteurs d’expression de virus recombinant (par exemple, virus mosaïque du chou fleur, CaMV; virus mosaïque du tabac, TMV) ou transformées avec des vecteurs d’expression de plasmide recombinant (par exemple, plasmide Ti) contenant une ou plusieurs séquences codantes.

Dans un système insecte utile, Autographica californica virus de la polyédrose nucléaire (AcNPV) est utilisé comme vecteur pour exprimer des gènes étrangers. Le virus se développe dans Spodoptera frugiperda cellules. Acide nucléique isolé codant pour les séquences sont clonées dans des régions non essentielles (par exemple le gène de la polyhédrine) du virus et placée sous contrôle d’un promoteur d’AcNPV (par exemple, le promoteur de polyèdre). L’insertion réussie des résultats de séquences codantes dans l’inactivation du gène de la polyhédrine et la production de virus recombinant non occlus (c’est à dire, un virus manquant de la couche protéique codée par le gène de polyèdre). Ces virus recombinants sont ensuite utilisés pour infecter desSpodoptera frugiperda cellules dans lesquelles le gène inséré est exprimé (par exemple, le brevet US. No. 4215051).

Des exemples de lignées de cellules hôtes de mammifères utiles comprennent les cellules VERO et HeLa, ovaire de hamster chinois (CHO), les lignées cellulaires W138, BHK, COS-7, 293, HepG2, NIH3T3, RIN et MDCK lignées cellulaires. En outre, une cellule hôte est de préférence choisie qui module l’expression des séquences insérées, ou modifie et traite le produit génique de la manière spécifique souhaitée. De telles modifications (par exemple, glycosylation) et de traitement (par exemple, clivage) de produits protéiques peuvent être importants pour la fonction de la protéine codée.

Différentes cellules hôtes ont des mécanismes caractéristiques et spécifiques pour le traitement et la modification des protéines en post-traduction. Des lignées cellulaires appropriées ou des systèmes hôtes sont de préférence choisis pour assurer la modification et le traitement corrects de la protéine étrangère exprimée. Les vecteurs d’expression pour une utilisation dans des cellules de mammifères comprennent ordinairement une origine de replication (si nécessaire), un promoteur situé en face du gène à exprimer, ainsi que tous les sites, les sites d’épissage d’ARN, site de polyadénylation, et des séquences de terminaison de la transcription de liaison de ribosome nécessaires. L’origine de replication est de préférence fournie par construction du vecteur pour inclure une origine exogène, telle qu’elle peut être dérivée de SV40 ou autre source virale (par exemple, polyome, adenovirus, VSV, BPV), ou peut être fourni par la cellule hôte mécanisme de replication chromosomique. Si le vecteur est intégré dans le chromosome de la cellule hôte, ce dernier est souvent suffisant.

Les promoteurs sont éventuellement dérivées du génome de cellules de mammifères (par exemple, promoteur de la métallothionéine) ou de virus de mammifères (par exemple, le promoteur tardif de l’adénovirus, le virus de la vaccine promoteur 7,5 K). En outre, il est également possible, et peut être souhaitable, d’utiliser des séquences promotrices ou de contrôle normalement associées à la séquence génique souhaitée, à condition que ces séquences de contrôle soient compatibles avec les systèmes de cellules hôtes.

Un certain nombre de systèmes d’expression à base virale peuvent être actionnés le présent mémoire, par exemple, des promoteurs couramment utilisés sont dérivés du polyome, de l’adénovirus 2, de l’adénovirus 5, le cytomégalovirus et le virus simien 40 (SV40). Les promoteurs précoces et tardifs du virus SV40 sont utiles car tous deux sont obtenus aisément à partir du virus en tant que fragment qui contient également l’origine virale de replication du SV40. Des fragments plus petits ou plus grands du SV40 sont également actionnable, en particulier quand il est inclus la séquence d’approximativement 250 pb s’étendant du site HindIII au site Bgll situé dans l’origine virale de replication.

Dans les cas où un adenovirus est utilisé comme vecteur d’expression, les séquences codantes sont de préférence ligaturés à un complexe de contrôle de transcription / traduction d’adénovirus, par exemple, le promoteur tardif et la séquence leader tripartite. Ce gène chimérique est ensuite éventuellement inséré dans le génome de l’adénovirus in vitro ou par recombinaison in vivo. L’insertion dans une région non essentielle du génome viral (par exemple, la région E1 ou E3) entraînera un virus recombinant qui est viable et capable d’exprimer des protéines dans des hôtes infectés.

Des signaux d’initiation spécifiques peuvent également être requis pour une traduction efficace des séquences codantes d’acide nucléique isolé revendiquées. Ces signaux comprennent le codon d’initiation ATG et les séquences adjacentes. Des signaux de contrôle de la traduction exogènes, y compris le codon d’initiation ATG, peuvent de plus avoir besoin d’être fournis. Une personne de compétence ordinaire dans l’art sera facilement capable de déterminer ce besoin et de fournir les signaux nécessaires. Il est bien connu que le codon d’initiation doit être en phase (ou en phase) avec le cadre de lecture de la séquence codante souhaitée pour assurer la traduction de l’insert entier. Ces signaux de contrôle traductionnel exogènes et ces codons d’initiation sont éventuellement d’une variété d’origines, tant naturelles que synthétiques. L’efficacité de l’expression est éventuellement renforcée par l’inclusion d’éléments amplificateurs de la transcription appropriés ou des terminateurs de transcription.

Dans l’expression eucaryotique, on souhaitera typiquement aussi d’incorporer dans l’unité transcriptionnelle un site de polyadénylation approprié si l’on n’a pas contenu dans le segment clone originel. Typiquement, le site poly A d’addition est placé à environ 30 à 2000 nucleotides «en aval» du site de terminaison de la protéine en une position avant la terminaison de la transcription.

Par long terme, de la production à haut rendement de protéines recombinantes, une expression stable est préférée. Par exemple, des lignées cellulaires qui expriment de façon stable les constructions codant pour les protéines ont été conçus. Plutôt que d’utiliser des vecteurs d’expression qui contiennent des origines virales de replication, les cellules hôtes sont de préférence transformées avec des vecteurs contrôlés par des éléments appropriés de contrôle d’expression (par exemple, promoteur, activateur, séquences, terminateurs de transcription, sites de polyadénylation, etc), et un marqueur sélectionnable. Après l’introduction de l’ADN étranger, les cellules modifiées peuvent être autorisées à croître pendant 1-2 jours dans un milieu enrichi, puis sont passés à un milieu sélectif. Le marqueur sélectionnable dans le plasmide recombinant confère une résistance à la sélection et permet aux cellules d’intégrer de façon stable le plasmide dans leurs chromosomes et de croître pour former des foyers qui, à leur tour, peuvent être clones et étendus en lignées cellulaires.

Un certain nombre de systèmes de sélection sont à titre d’exemple utilisé, y compris, mais sans s’y limiter, pour la thymidine kinase du virus de l’herpès simplex, l’hypoxanthine-guanine phosphoribosyltransférase et de gènes de l’adénine phosphoribosyltransférase, dans tk-, hgprt-ou aprt-cellules, respectivement. En outre, la résistance anti-métabolite est éventuellement utilisé en tant que base de sélection pour dhfr, qui confère une résistance au methotrexate; gpt, qui confère une résistance à l’acide mycophénolique; neo, qui confère une résistance à l’aminoglycoside G-418; et hygro, qui confère une résistance à l’hygromycine. On comprendra que de nombreux autres systèmes de sélection sont connus dans l’art qui sont pareillement être mis en oeuvre dans la présente invention.

Les acides nucléiques codant pour les peptides et les polypeptides de la présente invention sont éventuellement administrés en tant que vaccins d’acide nucléique. Aux fins de l’administration de vaccins, un acide nucléique codant pour un peptide ou polypeptide de la présente invention est de préférence dans un vecteur d’expression qui comprend l’acide nucléique viral, y compris, mais sans s’y limiter, le virus de la vaccine, adenovirus, retrovirus et / ou virus nucléique adéno-associé acide. L’acide nucléique ou le vecteur de la présente invention est éventuellement dans un liposome ou un véhicule de délivrance qui peut être absorbé par une cellule via médiée par le récepteur ou d’un autre type d’endocytose. Les vaccins d’acide nucléique de la présente invention sont de préférence dans un véhicule acceptable sur le plan pharmaceutique ou administrés avec un adjuvant. Les acides nucléiques codant pour les peptides et les polypeptides de la présente invention peuvent également être administrés à des cellules in vivo ou ex vivo.

Il est envisagé que les acides nucléiques isolés de l’invention sont éventuellement «surexprimé», c’est à dire, exprimé en des taux accrus par rapport à son expression naturelle dans les cellules de l’organisme indigène, ou même par rapport à l’expression d’autres protéines dans la cellule hôte recombinante. Une telle surexpression est évaluée par une variété de méthodes, y compris à titre d’exemple le radiomarquage et / ou la purification des protéines. Cependant, les procédés simples et directs sont préférés, par exemple, ceux impliquant SDS / PAGE et coloration des protéines ou immuno-empreinte, suivi par des analyses quantitatives, telles que le balayage densitométrique du gel ou blot résultant. Une augmentation spécifique par rapport au niveau en naturel dans les cellules transfectées dans le niveau de la protéine recombinante ou du peptide est indicative d’une surexpression, ce qui est une abondance relative de la protéine spécifique par rapport aux autres protéines produites par la cellule hôte et, par exemple, , visible sur un gel.

Divers vecteurs hétérologues sont décrits par ADN vaccinations contre les infections virales. Par exemple, les vecteurs décrits dans les références suivantes, incorporées ici à titre de référence, peuvent être utilisés pour exprimer des séquences hEbola à la place des séquences des virus ou autres agents pathogènes décrits; en particulier, les vecteurs décrits pour le virus de l’hépatite B (Michel, ML et al, 1995, la vaccination DAN médiation de l’antigène de surface de l’hépatite B chez les souris:… Aspects de la réponse imiter l’hépatite B virale humorale chez l’homme, Proc Natl Aca . Sci USA 92:5307-5311;.. Davis, HL et al, 1993, la vaccination à base d’ADN induit la sécrétion continue de l’antigène de surface de l’hépatite B et les niveaux élevés d’anticorps circulants, Molec génétique humaine 2:1847-1851), le VIH. . virus (Wang, B. et al, 1993, Gene inoculation génère des réponses immunitaires contre le virus de type 1 de l’immunodéficience humaine, Proc Natl Acad Sci USA 90:4156-4160;….. Lu, S. et al, 1996, Simian virus de l’immunodéficience essai de vaccin ADN dans Macques, J. Virol 70:3978-3991;.. Letvin, NL et al, 1997, réponses puissants, de protection anti-VIH immunitaires générées par l’ADN du VIH bimodale de l’enveloppe ainsi que la vaccination contre la protéine, Proc Natl Acad Sci USA . 94 (17) :9378-83), et les virus de la grippe (Robinson, HL et al, 1993, de la protection contre une provocation par le virus de la grippe mortelle par immunisation avec un ADN de plasmide exprimant l’hémagglutinine, Vaccine 11:957-960.; Ulmer, JB et al., Protection hétérologue contre la grippe par injection d’ADN codant une protéine virale, Science 259:1745-1749), ainsi que les infections bactériennes, telles que la tuberculose (Tascon, RE et al., 1996, la vaccination contre la tuberculose par injection d’ADN, Nature Med 2:888-892;… Huygen, K. et al, 1996, L’immunogénicité et l’efficacité protectrice d’un vaccin à ADN contre la tuberculose, Nature Med, 2:893-898), et une infection parasitaire, telle que le paludisme (Sedegah, M., 1994, Protection contre le paludisme par immunisation avec le plasmide ADN codant pour la protéine de circumsporozoïte, Proc Natl Acad Sci USA 91:9866-9870;….. Doolan, DL et al, 1996, Contourner restriction génétique de protection contre le paludisme à l’immunisation par ADN multigénique:…. CD8 + T cell-interféron delta, et l’immunité de l’oxyde nitrique-dépendante, J. Exper Med, 1183:1739-1746).

De nombreux procédés sont éventuellement utilisées pour introduire les formulations de vaccins décrites ci-dessus. Ceux-ci comprennent, mais ne sont pas limités à, intradermique, intramusculaire, intrapéritonéale, intraveineuse, sous-cutanée, intranasale et orale. En variante, dans un mode de réalisation préféré, la formulation de vaccin à virus chimérique est introduit par la voie naturelle d’infection du pathogène pour lequel le vaccin est conçu. Les vaccins à ADN de la présente invention sont éventuellement administrés en solutions salines par injection dans le muscle ou la peau à l’aide d’une seringue et d’une aiguille (1990, transfert JA Wolff et al gène direct dans le muscle de la souris in vivo, Science 247:1465-1468;. Raz , E., 1994, la vaccination intradermique génique: Le rôle possible de l’absorption d’ADN dans l’induction d’une immunité cellulaire de virus, c Natl Acd Sci USA 91:9519-9523)….. Une autre façon d’administrer les vaccins à ADN présentes utilisable est appelée la méthode «canon à gènes», dans lequel des billes d’or microscopiques enrobées avec les molécules d’ADN d’intérêt est tiré dans les cellules (Tang, D. et al., 1992, la vaccination génétique est une méthode simple pour provoquer une réponse immunitaire, Nature 356:152-154). Pour voir les avis généraux des méthodes de vaccins à ADN, voir Robinson, HL, 1999, les vaccins à ADN: mécanisme de base et les réponses immunitaires (avis), Int. J. Mol. Med. 4 (5) :549-555; Barber, B., 1997, Introduction: stratégies vaccinales émergents, Séminaires en immunologie 9 (5) :269-270; et Robinson, HL et al., 1997, les vaccins à ADN, Séminaires en immunologie 9 (5) :271-283.

Atténuation de hEbola virus ou variantes

Le virus hEbola ou variantes de l’invention sont éventuellement génétiquement modifiées pour présenter un phénotype atténué. En particulier, les virus de l’invention présentent un phénotype atténué chez un sujet auquel le virus est administré en tant que vaccin. L’atténuation peut être réalisée par toute méthode connue de l’homme du métier. Sans vouloir être lié par une théorie, le phénotype atténué du virus de l’invention est due, par exemple, en utilisant un virus qui naturellement ne se réplique pas bien dans une espèce d’hôtes visées, par exemple, par la réplication réduite du génome viral, par diminution de la capacité du virus à infecter une cellule hôte, ou par une capacité réduite des protéines virales à assembler à une particule virale infectieuse par rapport à l’espèce de type sauvage du virus.

Les phénotypes atténués du virus hEbola ou des variantes de ceux-ci sont éventuellement testées par toute méthode connue de l’homme du métier. Un virus candidat, par exemple, est le cas échéant testé pour sa capacité à infecter un hôte ou pour le taux de réplication dans un système de culture cellulaire. Dans certains modes de réalisation, les courbes de croissance à des températures différentes sont utilisées pour tester le phénotype atténué du virus. Par exemple, un virus atténué est capable de croître à 35 ° C, mais pas à 39 ° C ou 40 ° C. Dans certains modes de réalisation, différentes lignées cellulaires sont utilisés pour évaluer le phénotype atténué du virus. Par exemple, un virus atténué peut seulement être capables de se développer dans des lignées cellulaires de singe, mais pas les lignées de cellules humaines, ou des titres de virus réalisables dans différentes lignées cellulaires sont différentes pour le virus atténué. Dans certains modes de réalisation, la replication virale dans les voies respiratoires d’un petit modèle animal, y compris, mais sans s’y limiter, les hamsters, les rats du coton, des souris et des cochons d’Inde, est utilisé pour évaluer les phénotypes atténués du virus. Dans d’autres modes de réalisation, la réponse immunitaire induite par le virus, y compris, mais sans s’y limiter, les titres d’anticorps (par exemple, par réduction dosés plaque essai de neutralisation ou ELISA) sont utilisés pour évaluer les phénotypes atténués du virus. Dans un mode de réalisation spécifique, le test de neutralisation par réduction des plages ou ELISA est effectué à une faible dose. Dans certains modes de réalisation, la capacité du virus à provoquer hEbola symptômes pathologiques chez un modèle animal est testé. Une diminution de la capacité du virus à provoquer des symptômes pathologiques dans un système de modèle animal est un indicateur de son phénotype atténué. Dans un mode de réalisation spécifique, les virus candidats sont testés dans un modèle de singe de l’infection nasale, indiqué par la production de mucus.

Les virus de l’invention sont éventuellement atténuées de telle sorte que l’une ou plusieurs des caractéristiques fonctionnelles du virus sont altérées. Dans certains modes de réalisation, l’atténuation est mesurée par rapport à l’espèce de type sauvage du virus à partir duquel le virus atténué est dérivé. Dans d’autres modes de réalisation, l’atténuation est déterminée en comparant la croissance d’un virus atténué dans des systèmes hôtes différents. Ainsi, pour un exemple non limitatif, le virus hEbola ou un variant de celui-ci est atténué lorsqu’il est cultivé dans un hôte humain si la croissance de la hEbola ou un variant de celle-ci dans l’hôte humain est réduite par rapport à la hEbola non atténué ou un variant de celle-ci.

Dans certains modes de réalisation, le virus atténué de la présente invention est capable d’infecter un hôte, est capable de se répliquer dans un hôte tel que des particules virales infectieuses sont produites. Par rapport à l’espèce de type sauvage, cependant, l’espèce pousse atténué pour abaisser titres ou croît plus lentement. Toute technique connue de l’homme du métier peut être utilisée pour déterminer la courbe du virus atténué de la croissance et de la comparer à la courbe du virus de type sauvage de la croissance.

Dans certains modes de réalisation, le virus atténué de l’invention (par exemple, un recombinant ou chimérique hEbola) ne peut pas se répliquer dans les cellules humaines, ainsi que le virus de type sauvage (par exemple, de type sauvage hEbola) t. Cependant, le virus atténué peut se répliquer dans les puits d’une lignée cellulaire qui n’a pas d’interféron fonctions, telles que des cellules Vero.

Dans d’autres modes de réalisation, le virus atténué de la présente invention est capable d’infecter un hôte, de se répliquer dans l’hôte, et de provoquer des protéines du virus de l’invention à être inséré dans la membrane cytoplasmique, mais que le virus atténué ne provoque pas de l’hôte pour produire de nouvelles particules virales infectieuses. Dans certains modes de réalisation, le virus atténué infecte l’hôte, se réplique dans l’hôte, et provoque des protéines virales pour être insérés dans la membrane cytoplasmique de l’hôte avec la même efficacité que le type sauvage hEbola. Dans d’autres modes de réalisation, la capacité du virus atténué de causer des protéines virales pour être insérés dans la membrane cytoplasmique dans la cellule hôte est réduit par rapport au virus de type sauvage. Dans certains modes de réalisation, la capacité du virus atténué hEbola de se répliquer dans l’hôte est réduit par rapport au virus de type sauvage. Toute technique connue de l’homme du métier peut être utilisé pour déterminer si un virus est capable d’infecter une cellule de mammifère, de se répliquer dans l’hôte, et de provoquer des protéines virales pour être insérées dans la membrane cytoplasmique de l’hôte.

Dans certains modes de réalisation, le virus atténué de la présente invention est capable d’infecter un hôte. Par contraste avec le type sauvage hEbola, cependant, le hEbola atténué ne peut pas être répliqué dans l’hôte. Dans un mode de réalisation spécifique, le virus atténué hEbola peut infecter un hôte et l’hôte peut provoquer l’insertion des protéines virales dans les membranes cytoplasmiques, mais que le virus atténué n’est pas capable de se répliquer dans l’hôte. Toute méthode connue de l’homme du métier peut être utilisée pour tester si le hEbola atténué a infecté l’hôte et a provoqué l’hôte pour insérer des protéines virales dans les membranes cytoplasmiques.

Dans certains modes de réalisation, la capacité du virus atténué à infecter un hôte est réduit par rapport à la capacité du virus de type sauvage pour infecter le même hôte. Toute technique connue de l’homme du métier peut être utilisé pour déterminer si un virus est capable d’infecter un hôte.

Dans certains modes de réalisation, des mutations (par exemple, des mutations faux-sens) sont introduites dans le génome du virus, par exemple, dans la séquence de SEQ ID NO: 1 ou 10, ou pour générer un virus avec un phénotype atténué. Des mutations (par exemple, des mutations faux-sens) peuvent être introduites dans les gènes de structure et / ou des gènes de régulation de la hEbola. Les mutations sont éventuellement des additions, des substitutions, des suppressions ou des combinaisons de ceux-ci. Une telle variante de hEbola peut être criblée pour une fonctionnalité prédit, tel que l’infectivité, la capacité de réplication, la capacité de synthèse des protéines, l’assemblage de capacité, ainsi que l’effet cytopathique dans des cultures cellulaires. Dans un mode de réalisation spécifique, la mutation faux-sens est une mutation sensible au froid. Dans un autre mode de réalisation, la mutation faux-sens est une mutation sensible à la chaleur. Dans un autre mode de réalisation, la mutation faux-sens ou de traitement empêche un clivage des protéines virales normal.

Dans d’autres modes de réalisation, des délétions sont introduites dans le génome du virus hEbola, qui ont pour effet l’atténuation du virus.

Dans certains modes de réalisation, l’atténuation du virus est obtenue par le remplacement d’un gène du virus de type sauvage par un gène d’un virus d’une espèce différente, d’un sous-groupe différent, ou d’un variant différent. Dans un autre aspect, l’atténuation du virus est obtenue en remplaçant un ou plusieurs domaines d’une protéine du virus de type sauvage avec des domaines dérivés de la protéine correspondante d’un virus d’une espèce différente. Dans certains autres modes de réalisation, l’atténuation du virus est obtenue en supprimant une ou plusieurs domaines spécifiques d’une protéine du virus de type sauvage.

Quand un vaccin vivant atténué est utilisé, sa sécurité doit également être considérée. Le vaccin de préférence ne provoque pas de maladie. Toutes les techniques connues dans l’art pour améliorer la sécurité des vaccins sont utilisables dans la présente invention. En plus des techniques d’atténuation, d’autres techniques sont facultativement être utilisés. Un exemple non limitatif consiste à utiliser un gène hétérologue soluble qui ne peut être incorporé dans la membrane du virion. Par exemple, une seule copie de la version soluble d’une protéine transmembranaire virale manque les domaines transmembranaires et cytoplasmiques de celle-ci est utilisée.

Différents dosages sont éventuellement utilisés pour tester l’innocuité d’un vaccin. Par exemple, des gradients de sucrose et les essais de neutralisation sont utilisées pour tester la sécurité. Une analyse sur gradient de saccharose est éventuellement utilisée pour déterminer si une protéine hétérologue est inséré dans un virion. Si la protéine hétérologue est inséré dans le virion, le virion est de préférence testée pour sa capacité à provoquer des symptômes dans un modèle animal approprié, puisque le virus peut avoir acquis de nouvelles propriétés, éventuellement pathologiques.

5.4 adjuvants et des molécules porteuses

antigènes associés hEbola sont administrés avec un ou plusieurs adjuvants. Dans un mode de réalisation, l’antigène est associé hEbola-administré avec un adjuvant de sel minéral ou de gel de sel minéral adjuvant. De tels adjuvants de sels minéraux et de gel de sels minéraux comprennent, mais ne sont pas limités à, l’hydroxyde d’aluminium (ALHYDROGEL, REHYDRAGEL), le gel de phosphate d’aluminium, l’hydroxyphosphate d’aluminium (ADJU-PHOS) et le phosphate de calcium.

Dans un autre mode de réalisation, l’antigène associé à hEbola est administré avec un adjuvant immunostimulant. Une telle classe d’adjuvants comprennent, mais ne sont pas limités à, des cytokines (par exemple, l’interleukine-2, l’interleukine-7, l’interleukine-12, les colonies de granulocytes-macrophages facteur de stimulation (GM-CSF), l’interféron-γ de l’interleukine-1β (IL-1β ), et l’IL-1β ou peptidiques Sclavo peptidiques), des liposomes contenant des cytokines, des glycosides triterpénoïdes ou des saponines (par exemple, le QuilA et le QS-21, également vendus sous la marque commerciale Stimulon, ISCOPREP), Muramyl dipeptide (MDP), des dérivés tels que le N -acétyl-muramyl-L-thréonyl-D-isoglutamine (thréonyl-MDP, vendu sous la TERMURTIDE déposée), GMDP, la N-acétyl-nor-muramyl-L-alanyl-D-isoglutamine, la N-acétylmuramyl-L-alanyl- D-isoglutaminyle-L-alanine-2-(1′-2′-dipalmitoyl-sn-glycéro-3-hydroxy-phosphoryloxy)-éthylamine, le muramyl-tripeptide phosphatidyléthanolamine (MTP-PE) et des oligonucleotides, des dinucléotides CpG non méthylés, tels que l’ADN bactérien et des fragments de ceux-ci, le LPS, le lipide A monophosphorylé (3D-MLA vendu sous la dénomination commerciale MPL), et des polyphosphazènes.

Dans un autre mode de réalisation, l’adjuvant utilisé est un adjuvant particulier, y compris, mais sans s’y limiter, les emulsions, par exemple, l’adjuvant complet de Freund, l’adjuvant incomplet de Freund, le squalène ou des formulations squalane huile-dans-eau adjuvantes, comme les SAF et MF59, par exemple, préparé avec les copolymères à blocs, tels que L-121 (polyoxypropylène / polyoxyetheylene) commercialisé sous la marque PLURONIC L-121, des liposomes, des virosomes, des cochléates, et des complexes de stimulation immunitaire, qui est vendu sous la marque commerciale ISCOM.

Dans un autre mode de réalisation, un adjuvant est utilisé microparticulaire. Microparticulaire adjuvants comprennent, mais ne sont pas limités à, des polyesters biodégradables et biocompatibles, les homo-et copolymères d’acide lactique (PLA) et d’acide glycolique (PGA), le poly (lactide-co-glycolides) (PLGA), des microparticules, des polymères qui s’auto-associer en particules (particules de poloxamères), les polymères solubles (polyphosphazènes) et des particules de type virus (VLP) comme les particules recombinantes de protéines, par exemple, l’antigène de surface de l’hépatite B (HBsAg).

Encore une autre classe d’adjuvants qui sont utilisés comprennent éventuellement des adjuvants muqueux, y compris, mais sans s’y limiter, l’entérotoxine thermolabile de Escherichia coli (LT), l’holotoxine cholérique (CT) et la sous-unité B de la toxine cholérique (CTB) de Vibrio cholerae , les toxines mutantes (par exemple, , LTK63 et LTR72), des microparticules et des liposomes polymérisés.

Dans d’autres modes de réalisation, l’une des classes ci-dessus sont éventuellement des adjuvants utilisés en combinaison les uns avec les autres ou avec d’autres adjuvants. Par exemple, des exemples non limitatifs de préparations adjuvantes de combinaison utilisés pour administrer des antigènes hEbola-liés de l’invention comprennent des liposomes contenant des protéines immunostimulantes, des cytokines, des peptides de cellules T et / ou des cellules B, ou des microbes, avec ou sans piégé IL-2 ou des microparticules contenant l’entérotoxine. D’autres adjuvants connus dans l’art sont également inclus dans le champ d’application de l’invention (voir vaccin. Conception: Le sous-unité et approche adjuvant, chap 7, Michael F. Powell et Mark J. Newman (eds.), Plenum Press, New York, 1995, qui est incorporé ici dans son intégralité).

L’efficacité d’un adjuvant est déterminée en mesurant de manière illustrative l’induction d’anticorps dirigés contre un polypeptide immunogène contenant un épitope d’un polypeptide hEbola, les anticorps résultant de l’administration de ce polypeptide dans des vaccins qui sont également constitués de divers adjuvants.

Les polypeptides sont éventuellement formulés en vaccin sous des formes neutres ou salines. Les sels pharmaceutiquement acceptables comprennent les sels d’addition d’acides (formés avec les groupes amino libres du peptide) et qui sont formés avec des acides inorganiques, tels que, par exemple, les acides chlorhydrique ou phosphorique, ou des acides organiques tels que les acides acétique, oxalique, tartrique, maléique, et analogues. Les sels formés avec les groupes carboxyle libres sont éventuellement dérivés de bases inorganiques, tels que, par exemple, sodium potassium, ammonium, calcium, ou les hydroxydes ferriques, et des bases organiques telles que l’isopropylamine, la triméthylamine, 2-éthylamino éthanol, l’histidine, la procaine et analogues .

Les vaccins de l’invention sont de préférence monovalent ou multivalent. Les vaccins multivalents sont fabriqués à partir de virus recombinants qui dirigent l’expression de plus d’un antigène.

De nombreux procédés sont ici mis en oeuvre pour introduire les formulations de vaccins de l’invention; ceux-ci comprennent, mais ne sont pas limités à administration orale, intradermique, intramusculaire, intrapéritonéale, intraveineuse, sous-cutanée, la voie intranasale, et par l’intermédiaire de scarification (grattage à travers les couches supérieures de la peau, par exemple, en utilisant une aiguille bifurquée).

Le patient auquel le vaccin est administré est de préférence un mammifère, de préférence un humain, mais il est aussi éventuellement un animal non humain y compris, mais sans s’y limiter, les primates inférieurs, les vaches, les chevaux, les moutons, les porcs, les volailles (par exemple les poulets), les chèvres, les chats, les chiens, les hamsters, les souris et les rats.

Préparation d’anticorps

Des anticorps qui reconnaissent spécifiquement un polypeptide de l’invention, tels que, mais non limités à, des polypeptides dont la séquence de SEQ ID NO: 2-9, 59, ou 11 à 19 et d’autres polypeptides tels que décrits ici, ou hEbola épitope ou antigène- des fragments de liaison de ceux-ci sont utilisés dans un mode de réalisation préféré pour la détection, le dépistage et l’isolement du polypeptide de l’invention ou des fragments de ceux-ci, ou des séquences similaires qui pourraient coder pour des enzymes similaires d’autres organismes. Par exemple, dans un mode de réalisation spécifique, un anticorps qui se lie de manière immunospécifique épitope hEbola, ou un fragment de celui-ci, est utilisé pour divers dosages in vitro de détection, y compris les dosages d’immuno-enzymatiques (ELISA), radio-immunologiques, western blot, etc, pour l’ la détection d’un polypeptide de l’invention ou, de préférence, hEbola, dans des échantillons, par exemple, un matériau biologique, y compris les cellules, les milieux de culture cellulaire (par exemple, support bactérien de la culture cellulaire de mammifère milieux de culture cellulaire, les insectes des milieux de culture cellulaire, de la levure de culture cellulaire médias, etc), le sang, le plasma, le sérum, les tissus, les crachats, ponctions naseopharyngeal, etc

Des anticorps spécifiques pour un polypeptide de l’invention ou de tout épitope de hEbola sont éventuellement générées par tout procédé approprié connu dans l’art. Des anticorps polyclonaux à un antigène d’intérêt, par exemple, le virus de hEbola fort Accession n ° 200706291, ou comprenant une séquence nucléotidique de SEQ ID NO: 1 ou 10, sont éventuellement produites par divers procédés bien connus dans l’art. Par exemple, un antigène est éventuellement administré à divers animaux hôtes, y compris, mais sans s’y limiter, des lapins, des souris, des rats, etc, pour induire la production d’anti-sérums contenant des anticorps polyclonaux spécifiques de l’antigène. Divers adjuvants sont éventuellement utilisés pour augmenter la réponse immunologique, en fonction de l’espèce hôte, et comprennent, mais ne sont pas limités à, l’adjuvant (complet et incomplet) de Freund, des gels minéraux tels que l’hydroxyde d’aluminium, des substances tensioactives telles que la lysolécithine, des polyols Pluronic, des polyanions, des peptides, des emulsions huileuses, les hémocyanines de patelle en trou de serrure, le dinitrophénol et des adjuvants humains potentiellement utiles pour tels que le BCG (bacille de Calmette-Guérin) et Corynebacterium parvum . De tels adjuvants sont également bien connus dans la technique.

Des anticorps monoclonaux sont préparés en utilisant éventuellement une grande variété de techniques connues dans l’art, y compris l’utilisation d’hybridomes, recombinantes, et les technologies d’affichage de phage, ou une combinaison de ceux-ci. Dans un exemple, des anticorps monoclonaux sont produits en utilisant des techniques d’hybridomes incluant celles connues dans l’art et enseignées, par exemple, dans Harlow et al, Antibodies:. A Laboratory Manual (. Cold Spring Harbor Laboratory Press, 2nd ed, 1988); . Hammerling, et al, dans: Monoclonal Antibodies and T-Cell Hybridomas, pages 563-681 (Elsevier, NY, 1981) (qui sont tous deux incorporés par référence dans leur intégralité). L’expression «anticorps monoclonal» telle qu’utilisée ici n’est pas limitée aux anticorps produits par la technologie des hybridomes. Le terme « anticorps monoclonal » désigne un anticorps qui est dérivé d’un clone unique, incluant toute eucaryote, procaryote, ou clone de phage, et non le procédé par lequel il est produit.

Les procédés de production et de criblage d’anticorps spécifiques utilisant la technologie des hybridomes sont routiniers et bien connus dans l’art. Dans un exemple non limitatif, les souris sont immunisées avec un antigène d’intérêt ou d’une cellule exprimant un tel antigène. Une fois qu’une réponse immunitaire est détectée, par exemple, des anticorps spécifiques de l’antigène sont détectés dans le sérum de la souris, la rate de la souris est récoltée et les splénocytes isolés. Les splénocytes sont ensuite fusionnés par des techniques bien connues à n’importe quelles cellules de myélome appropriées. Des hybridomes sont sélectionnés et clones par dilution limitante. Les clones d’hybridomes sont ensuite testés par des procédés connus dans la technique pour des cellules qui sécrètent des anticorps capables de se lier à l’antigène. Le fluide ascitique, qui contient généralement des niveaux élevés d’anticorps, est éventuellement généré en inoculant à des souris par voie intraperitoneale avec des clones d’hybridomes positifs.

Des fragments d’anticorps qui reconnaissent des épitopes spécifiques sont éventuellement générés par des techniques connues. Par exemple, les fragments Fab et F (ab ‘) 2 fragments sont produites à titre d’exemple par clivage protéolytique de molécules d’immunoglobuline, en utilisant des enzymes telles que la papaïne (pour produire des fragments Fab) ou la pepsine (pour produire F (ab ‘) 2 fragments). F (ab ‘) 2 fragments contiennent de préférence de la chaîne complète de la lumière, et la région variable, la région CH1 et la région charnière de la chaîne lourde.

Les anticorps de l’invention ou des fragments de ceux-ci sont éventuellement produits par n’importe quel procédé connu dans la technique pour la synthèse d’anticorps, en particulier, par synthèse chimique ou, de préférence, par des techniques d’expression recombinante.

La séquence nucléotidique codant pour un anticorps est obtenu à partir de toutes les informations disponibles pour l’homme de l’art (par exemple, auprès de Genbank, la littérature, ou par clonage de routine et l’analyse de séquence). Si un clone contenant un acide nucléique codant pour un anticorps particulier ou un fragment liant un épitope de celui-ci n’est pas disponible, mais la séquence de la molécule d’anticorps ou un fragment d’épitope de liaison de celle-ci est connue, un acide nucléique codant pour l’immunoglobuline peut être synthétisé ou obtenu par voie chimique à partir d’une source appropriée (par exemple, une bibliothèque d’anticorps d’ADNc, ou une banque d’ADNc générée à partir de, ou un acide nucléique, un poly préférence A + ARN, isolé à partir de n’importe quel tissu ou des cellules exprimant l’anticorps, telles que des cellules d’hybridome sélectionnées pour exprimer un anticorps) par L’amplification par PCR en utilisant des amorces synthétiques hybridables aux extrémités 3 ‘et 5’ de la séquence ou par clonage en utilisant une sonde oligonucléotidique spécifique de la séquence de gène particulière à identifier, par exemple, un clone d’ADNc à partir d’une banque d’ADNc qui code pour l’anticorps. Les acides nucléiques amplifiés générés par PCR sont ensuite éventuellement clonées dans des vecteurs de clonage réplicables en utilisant tout procédé connu dans l’art.

Une fois que la séquence nucléotidique de l’anticorps est déterminée, la séquence nucléotidique de l’anticorps est éventuellement manipulée en utilisant des procédés bien connus dans la technique pour la manipulation de séquences nucléotidiques, par exemple, des techniques d’ADN recombinant, la mutagenèse dirigée, la PCR, etc (voir, par exemple, les techniques décrites dans Sambrook et al, précité;… et Ausubel et al, eds, 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, qui sont tous deux incorporés ici par référence dans leur intégralité), pour générer des anticorps ayant une séquence d’acides aminés différente, par exemple, en introduisant des substitutions d’acides aminés, des délétions et / ou insertions dans des régions du domaine épitope de liaison des anticorps ou une partie d’anticorps, qui peuvent augmenter ou réduire les activités biologiques des anticorps .

L’expression recombinante d’un anticorps nécessite la construction d’un vecteur d’expression contenant une séquence nucléotidique qui code pour l’anticorps. Une fois qu’une séquence nucléotidique codant pour une molécule d’anticorps ou une chaîne lourde ou légère d’un anticorps, ou une partie de celui-ci a été obtenue, le vecteur pour la production de la molécule d’anticorps est éventuellement produit par la technologie de l’ADN recombinant en utilisant des techniques connues dans l’art comme on le verra dans les sections précédentes. Des procédés qui sont connus de l’homme de l’art sont éventuellement utilisés pour construire des vecteurs d’expression contenant des séquences codantes d’anticorps et des signaux de transcription et de translation de contrôle appropriées. Ces procédés comprennent, par exemple, des techniques in vitro d’ADN recombinant, des techniques de synthèse et la recombinaison génétique in vivo. La séquence nucléotidique codant pour la région variable de chaîne lourde, la lumière région variable de chaîne, à la fois la chaîne lourde et des régions variables de chaînes légères, un fragment de l’épitope de liaison de la lourde et / ou légère région variable de chaîne, ou un ou plus régions déterminant la complémentarité (CDR) d’un anticorps sont éventuellement clone dans un tel vecteur pour l’expression. Ainsi, vecteur d’expression est préparé éventuellement ensuite introduit dans des cellules hôtes appropriées pour l’expression de l’anticorps. En conséquence, l’invention inclut des cellules hôtes contenant un polynucleotide codant pour un anticorps spécifique pour des polypeptides de l’invention ou des fragments de ceux-ci.

La cellule hôte est éventuellement co-transfectée avec deux vecteurs d’expression de l’invention, le premier vecteur codant pour un polypeptide dérivé de chaîne lourde et le deuxième vecteur codant pour un polypeptide dérivé de chaîne légère. Les deux vecteurs contiennent à titre d’exemple les marqueurs sélectionnables identiques qui permettent une expression équivalente des polypeptides des chaînes lourde et légère ou des différents marqueurs sélectionnables pour assurer le maintien des deux plasmides. En variante, un vecteur unique est éventuellement utilisé qui code, et est capable d’exprimer, à la fois lourd et polypeptides de la chaîne légère. Dans de telles situations, la chaîne légère doit être placée avant la chaîne lourde pour éviter un excès de toxiques chaîne lourde libre (Proudfoot, Nature, 322:52, 1986, et Kohler, Proc Natl Acad Sci USA, 77:2…. 197, 1980). Les séquences codantes pour les chaînes lourdes et légères comprennent éventuellement ADNc ou d’ADN génomique.

Dans un autre mode de réalisation, les anticorps sont produits en utilisant divers procédés de présentation sur phage connus dans l’art. Dans les procédés de présentation sur phage, des domaines d’anticorps fonctionnels sont affichés sur la surface de particules de phage qui portent les séquences polynucléotidiques les codant. Dans un mode de réalisation particulier, un tel phage est utilisé pour présenter des domaines de liaison à l’antigène, tels que les fragments Fab et Fv ou un disulfure liaison Fv stabilisé, exprimée à partir d’un répertoire ou d’une bibliothèque combinatoire d’anticorps (par exemple, humaine ou murine). Le phage exprimant un domaine de liaison à l’antigène qui se lie à l’antigène d’intérêt est éventuellement sélectionné ou identifié avec l’antigène, par exemple, en utilisant un antigène ou un antigène lié ou capturé sur une surface solide ou une bille marquée. Les phages utilisés dans ces procédés sont typiquement des phages filamenteux, incluant fd et M13. Les domaines de liaison à l’antigène sont exprimés sous forme de protéine recombinante fusionnée à l’une ou l’autre gène de la protéine du phage III ou du gène VIII. Des exemples de procédés de présentation sur phage qui peuvent être utilisés pour fabriquer des immunoglobulines ou des fragments de ceux-ci, de la présente invention comprennent ceux décrits dans Brinkman et al., J. Immunol. Méthodes, 182:41-50, 1995; Ames et al., J. Immunol. Méthodes, 184:177-186, 1995; Kettleborough et al., Eur. J. Immunol, 24:952-958, 1994.; . Persique et al, Gene, 187:9-18, 1997; . Burton et al, Advances in Immunology, 57:191-280, 1994; demande PCT n ° PCT/GB91/01134; Publications PCT WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; et US. N ° 5698426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5733743 5969108 et; dont chacun est incorporé ici par référence dans son intégralité.

Comme décrit dans les références ci-dessus, après sélection du phage, les anticorps de codage de régions à partir du phage est éventuellement isolé et utilisé pour générer des anticorps entiers, y compris des anticorps humains, ou tout autres fragments souhaités, et exprimée dans n’importe quel hôte souhaité, y compris des cellules de mammifère, d’insecte les cellules, les cellules végétales, les levures et les bactéries, par exemple, comme décrit en détail ci-dessous. Par exemple, les techniques pour produire par recombinaison des fragments Fab, Fab ‘et F (ab’) 2 fragments sont éventuellement employées en utilisant des procédés connus dans l’art tels que ceux décrits dans la publication PCT WO 92/22324; . Mullinax et al, BioTechniques, 12 (6) :864-869, 1992; . et Sawai et al, AJR1, 34:26-34, 1995; et Better et al., Science, 240:1041-1043, 1988 (dont chacun est incorporé par référence dans son intégralité). Des exemples de techniques pouvant être actionnés pour produire des Fv à chaîne unique et des anticorps comprennent ceux décrits dans le brevet des Etats-Unis. N ° 4946778 et 5258498; Huston et al, Methods in Enzymology, 203:46-88, 1991.; . Shu et al, PNAS, 90:7995-7999, 1993; et Skerra et al., Science, 240:1038-1040, 1988.

Une fois qu’une molécule d’anticorps de l’invention a été produite par des procédés décrits ci-dessus, ou autrement connu dans l’art, il est ensuite éventuellement purifié par n’importe quel procédé connu dans la technique pour la purification d’une molécule d’immunoglobuline, par exemple, par Chromatographie (par exemple, échange d’ions, affinité, en particulier par affinité pour l’antigène spécifique après la Protéine A ou Protéine G de purification, et une chromatographie sur colonne de dimensionnement), centrifugation, solubilité différentielle, ou par toute autre technique standard (s) pour la purification de protéines. En outre, les anticorps de la présente invention ou des fragments de ceux-ci sont éventuellement fusionnés à des séquences polypeptidiques hétérologues décrites ici ou autrement connues dans la technique pour faciliter la purification. Des exemples comprennent 6 × His, étiquette FLAG, la biotine, l’avidine, ou un autre système.

Pour certaines utilisations, y compris l’utilisation d’anticorps in vivo chez l’homme et dans des essais de détection in vitro, il est préférable d’utiliser des anticorps chimériques, humanisés ou humains. Un anticorps chimérique est une molécule dans laquelle différentes portions de l’anticorps sont dérivées de différentes espèces animales, telles que des anticorps ayant une région variable dérivée d’un anticorps monoclonal murin et une région constante dérivée d’une immunoglobuline humaine. Des procédés pour produire des anticorps chimériques sont connus dans l’art. Voir, par exemple, Morrison, Science, 229:1202, 1985; . Oi et al, BioTechniques, 4:214 1986; Gillies et al., J. Immunol. Méthodes, 125:191-202, 1989; Le brevet US. N ° 5807715; 4,816,567; et 4816397, qui sont incorporés ici par référence dans leur intégralité. Les anticorps humanisés sont des molécules d’anticorps provenant d’espèces non humaines qui se lient à l’antigène souhaité ayant une ou plusieurs régions déterminant la complémentarité (CDR) provenant des espèces non humaines et des régions de charpente provenant d’une molécule d’immunoglobuline humaine. Souvent, les résidus de charpente dans les régions charpentes humaines seront substitués par le résidu correspondant de l’anticorps donneur de CDR pour modifier, de préférence améliorer, la liaison antigène. Ces substitutions cadres sont identifiées par des procédés bien connus dans la technique, par exemple par modélisation des interactions de la CDR et des résidus de charpente pour identifier les résidus importants pour la liaison à l’antigène et la comparaison afin d’identifier des résidus de charpente inhabituels à des positions particulières séquence cadres. Voir, par exemple, de la Reine et al., Le brevet US. N ° 5585089; Riechmann et al., Nature, 332:323, 1988, qui sont incorporés ici par référence dans leur intégralité. Les anticorps sont humanisés en utilisant une variété de techniques connues dans l’art, y compris, par exemple, greffe de CDR (EP 239 400, la publication PCT WO 91/09967; le brevet US n ° 5,225,539;. 5.530.101 et 5.585.089), le placage ou le resurfaçage (EP 592 106; EP 519596; Padlan, immunologie moléculaire, 28 (4/5) :489-498, 1991;. Studnicka et al, ingénierie des protéines, 7 (6) :805-814, 1994;.. Roguska et al, Proc Natl Acad. Sci. USA, 91:969-973, 1994), et brassage de chaîne (brevet US. No. 5565332), qui sont incorporés par référence dans leur intégralité.

Des anticorps totalement humains sont particulièrement souhaitables pour un traitement thérapeutique de patients humains. Des anticorps humains sont faits par une diversité de procédés connus dans la technique y compris à titre d’exemple des procédés de présentation sur phages décrits ci-dessus en utilisant des bibliothèques d’anticorps dérivées de séquences d’immunoglobulines humaines. Voir le brevet US. N ° 4444887 et 4716111; et les publications PCT WO 98/46645; WO 98/50433; WO 98/24893; WO 98/16654; WO 96/34096; WO 96/33735; et WO 91/10741, dont chacun est incorporé ici par référence dans son intégralité.

Les anticorps humains sont également produites à titre d’exemple en utilisant des souris transgéniques qui sont incapables d’exprimer des immunoglobulines endogènes fonctionnelles, mais qui peuvent exprimer des gènes d’immunoglobulines humaines. Pour un aperçu de cette technologie pour produire des anticorps humains, voir Lonberg et Huszar, Int. Rev Immunol, 13:65-93, 1995 Pour une discussion détaillée de cette technologie pour produire des anticorps humains et d’anticorps monoclonaux humains et des protocoles de production de ces anticorps, voir, par exemple, les publications PCT WO 98/24893..; WO 92/01047; WO 96/34096; WO 96/33735; Brevet européen n ° 0 598 877; Le brevet US. N ° 5413923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; et 5939598, qui sont incorporés ici par référence dans leur intégralité. En outre, des entreprises comme Abgenix, Inc. (Fremont, Californie), Medarex (NJ) et Genpharm (San Jose, Californie) peuvent être engagés pour fournir des anticorps humains dirigés contre un antigène sélectionné en utilisant une technologie similaire à celle décrite ci-dessus.

Des anticorps totalement humains qui reconnaissent un epitope sélectionné sont éventuellement produites à l’aide d’une technique appelée « sélection guidée. » Dans cette approche, un anticorps monoclonal non humain sélectionné, par exemple, un anticorps de souris, est utilisé pour guider la sélection d’un anticorps complètement humain en reconnaissant le même épitope. (Jespers et al., Bio / technologie, 12:899-903, 1988).

Les anticorps fusionnés ou conjugués à des polypeptides hétérologues sont éventuellement utilisés dans des dosages immunologiques in vitro et dans des procédés de purification (par exemple, Chromatographie d’affinité) connu dans l’art. Voir, par exemple, la publication PCT n ° WO 93/21232; EP 439095; Naramura et al., Immunol. Lett, 39:91-99, 1994.; Le brevet US. N ° 5474981; . Gillies et al, PNAS, 89:1428-1432, 1992; et Fell et al., J. Immunol., 146:2446-2452, 1991, qui sont incorporés ici par référence dans leur intégralité.

Les anticorps peuvent également être fixés de manière illustrative à des supports solides, qui sont particulièrement utiles pour des dosages immunologiques ou une purification des polypeptides de l’invention ou des fragments, des dérivés, des analogues ou des variants de ceux-ci, ou des molécules similaires ayant les activités enzymatiques similaires à celles du polypeptide de l’invention. De tels supports solides incluent, mais ne sont pas limités à, le verre, la cellulose, le Polyacrylamide, le nylon, le polystyrène, le polychlorure de vinyle ou polypropylène.

Compositions et kits pharmaceutiques

La présente invention englobe des compositions pharmaceutiques comprenant des agents antiviraux de la présente invention. Dans un mode de réalisation spécifique, l’agent antiviral est de préférence un anticorps qui se lie de manière immunospécifique et neutralise le virus hEbola ou variants de ceux-ci, ou toute protéine dérivée de celle-ci. Dans un autre mode de réalisation spécifique, l’agent antiviral est un polypeptide ou une molécule d’acide nucléique de l’invention. Les compositions pharmaceutiques sont utiles en tant qu’agent prophylactique antiviral est illustrative administré à un sujet, où le sujet a été exposé ou est prévu pour être exposé à un virus.

Divers systèmes de délivrance sont connus et fonctionner de façon à administrer la composition pharmaceutique de l’invention, à titre d’exemple, l’encapsulation dans des liposomes, des microparticules, des microcapsules, des cellules recombinantes capables d’exprimer les virus mutants et du récepteur médiée par endocytose (voir, par exemple, Wu et Wu, 1987, . J. Biol. Chem 262:4429 4432). Les méthodes d’introduction comprennent, mais ne sont pas limités à intradermique, intramusculaire, intrapéritonéale, intraveineuse, sous-cutanée, intranasale, épidurale, et orale. Les composés peuvent être administrés par toute voie commode, par exemple par perfusion ou injection de bolus, par absorption à travers les revêtements épithéliaux ou muco-cutanées (par exemple, muqueuse buccale, muqueuse rectale et intestinale, etc) et éventuellement administrés conjointement avec d’autres agents biologiquement actifs. Administration systémique ou locale. Dans un mode de réalisation préféré, il est souhaitable d’introduire les compositions pharmaceutiques de l’invention dans les poumons par toute voie appropriée. L’administration pulmonaire peut également être employée, par exemple, par l’utilisation d’un inhalateur ou nébuliseur, et formulation avec un agent aérosol.

Dans un mode de réalisation spécifique, il est souhaitable d’administrer les compositions pharmaceutiques de l’invention localement à la zone nécessitant un traitement. Cette administration peut être réalisée par, par exemple, et non à titre de limitation, par perfusion locale pendant une intervention chirurgicale, application topique, par exemple conjointement avec un pansement après une intervention chirurgicale, par injection, au moyen d’un cathéter, au moyen d’un suppositoire , au moyen de pulvérisation nasale, ou au moyen d’un implant, l’implant étant d’un matériau poreux, non poreux ou gélatineux, comprenant des membranes, telles que des membranes sialastiques, ou des fibres. Dans un mode de réalisation, l’administration peut se faire par injection directe sur le site (ou ancien site) tissus infectés.

Dans un autre mode de réalisation, la composition pharmaceutique est délivré dans une vésicule, en particulier un liposome (voir Langer, 1990, Science 249:1527-1533;. Traiter et al, dans des liposomes dans la thérapie des maladies infectieuses et le cancer, Lopez Berestein et Fidler (eds.), Liss, New York, pp 353-365 (1989);. Lopez-Berestein, ibid, pp 317-327, voir ibid généralement)..

Dans encore un autre mode de réalisation, la composition pharmaceutique est délivré dans un système à libération contrôlée. Dans un mode de réalisation, on utilise une pompe (voir Langer, supra; Sefton, 1987, CRC Crit Réf Biomed Eng 14:201;…. Buchwald et al, 1980, 88:507 Chirurgie;. Et Saudek et al, 1989. , N. Engl. J. Med. 321:574). Dans un autre mode de réalisation, des matériaux polymères sont utilisés (voir Medical Applications of Controlled Release, Langer et Wise (dir.), CRC Pres, Boca Raton, en Floride (1974);. Contrôlée biodisponibilité des médicaments, les produits pharmaceutiques conception et de performances, de boule et Smolen (eds.), Wiley, New York (1984);…. Ranger et Peppas, J. Macromol Sci Rev Macromol Chem 23:61 (1983); voir également Levy et al, 1985, Science 228:190.; Pendant et al, 1989, Ann Neurol 25:351;….. Howard et al, 1989, J. Neurosurg 71:105). Dans encore un autre mode de réalisation, un système à libération contrôlée est placé à proximité de la cible de la composition, c’est à dire, le poumon, donc, ne nécessitant qu’une fraction de la dose systémique (voir, par exemple, Goodson, dans Medical Applications of Controlled Release, précité, vol . 2, pp 115-138 (1984)).

D’autres systèmes de libération contrôlée sont discutés dans la revue de Langer (Science 249:1527-1533 (1990)), les contenus sont incorporés ici par référence.

Les compositions pharmaceutiques de la présente invention comprennent à titre d’illustration d’une quantité thérapeutiquement efficace d’un virus vivant atténué, un virus inactivé ou tué hEbola Afrique de l’Ouest, ou virus recombinant ou chimérique hEbola, et un support pharmaceutiquement acceptable. Dans un mode de réalisation spécifique, le terme « pharmaceutiquement acceptable » signifie approuvé par un organisme de réglementation du gouvernement fédéral ou d’un gouvernement d’un Etat ou figurant dans la pharmacopée des États-Unis ou une autre pharmacopée généralement reconnue pour une utilisation chez les animaux, et plus particulièrement chez l’homme. Le terme « support » désigne un diluant, adjuvant, excipient, ou véhicule avec lequel la composition pharmaceutique est administrée. De tels véhicules pharmaceutiques sont à titre d’illustration des liquides stériles, tels que l’eau et les huiles, y compris celles d’origine pétrolière, animale, végétale ou synthétique, telles que l’huile d’arachide, l’huile de soja, l’huile minérale, l’huile de sésame et analogues. L’eau est un véhicule préféré lorsque la composition pharmaceutique est administrée par voie intraveineuse. Des solutions salines et des solutions aqueuses de dextrose et de glycerol sont éventuellement utilisées en tant que supports liquides, particulièrement pour des solutions injectables. Des excipients pharmaceutiques appropriés comprennent l’amidon, le glucose, le lactose, le saccharose, la gélatine, le malt, le riz, la farine, la craie, le gel de silice, le stéarate de sodium, le monostéarate de glycerol, le talc, le chlorure de sodium, le lait écrémé en poudre, le glycerol, le propylene, le glycol, l’eau, l’éthanol et l’ etc. La composition, si on le désire, contient également des agents mouillants ou émulsifiants, ou des agents tamponnant le pH. Ces compositions prennent éventuellement sous forme de solutions, suspensions, emulsion, comprimés, pilules, capsules, poudres, formulations à libération prolongée et analogues. La composition est éventuellement formulée sous forme de suppositoire, avec des liants et des supports traditionnels tels que les triglycérides. Une formulation orale comprend de manière illustrative des supports classiques tels que des qualités pharmaceutiques de mannitol, lactose, amidon, stéarate de magnésium, saccharine sodique, cellulose, carbonate de magnésium, etc Des exemples de supports pharmaceutiques appropriés sont décrits dans «Remington ‘s Pharmaceutical Sciences » par Martin EW. La formulation doit convenir au mode d’administration.

Dans un mode de réalisation préféré, la composition est formulée conformément à des procédures de routine comme une composition pharmaceutique adaptée pour une administration intraveineuse à des êtres humains. Typiquement, les compositions pour administration intraveineuse sont des solutions dans un tampon aqueux isotonique stérile. La composition comprend également un agent solubilisant optionnel et un anesthésique local tel que la lidocaïne pour soulager la douleur au site de l’injection. En général, les ingrédients sont fournis soit séparément soit mélangés ensemble dans une forme posologique unitaire, par exemple sous forme d’une poudre lyophilisée sèche ou de concentré sans eau dans un récipient hermétiquement scellé tel qu’une ampoule ou un sachet indiquant la quantité d’agent actif. Lorsque la composition est destinée à être administrée par perfusion, elle peut être distribuée avec une bouteille de perfusion contenant de l’eau de qualité pharmaceutique stérile ou du sérum physiologique. Lorsque la composition est administrée par injection, une ampoule d’eau stérile pour injection ou une solution saline est éventuellement fourni de sorte que les ingrédients puissent être mélangés avant l’administration.

Les compositions pharmaceutiques de l’invention sont à titre d’exemple formulés sous des formes neutres ou salines. Les sels pharmaceutiquement acceptables comprennent à titre d’exemple ceux formés avec des groupes amino libres tels que ceux dérivés d’, phosphorique, acétique, oxalique, tartrique chlorhydrique, etc, et ceux formés avec des groupes carboxyle libres tels que ceux dérivés de sodium, potassium, ammonium, calcium, des hydroxydes ferriques, isopropylamine, triéthylamine, 2 éthylamino éthanol, histidine, procaine, etc

La quantité de la composition pharmaceutique de l’invention qui sera efficace dans le traitement d’un trouble ou d’un état particulier dépendra de la nature du trouble ou de l’état, et peut être déterminée par des techniques cliniques standard. En outre, des dosages in vitro sont éventuellement employés pour aider à identifier les plages de dosage optimales. La dose précise à employer dans la formulation dépendra également de la voie d’administration, et la gravité de la maladie ou du trouble, et doit être décidée selon le jugement du praticien et les circonstances de chaque patient. Cependant, les plages de dosage appropriées pour l’administration intraveineuse sont généralement d’environ 20 à 500 microgrammes de composé actif par poids de corps de kg. Les plages de dosage appropriées pour l’administration intranasale sont généralement d’environ 0,01 pg / kg de poids corporel à 1 mg / kg de poids corporel. Les doses efficaces peuvent être extrapolées à partir de courbes de dose-réponse dérivées de systèmes d’essai modèles animaux ou in vitro.

Les suppositoires contiennent généralement l’ingrédient actif dans la plage de 0,5% à 10% en poids; les formulations orales contiennent de préférence 10% à 95% d’ingrédient actif.

L’invention fournit également un pack ou un kit pharmaceutique comprenant un ou plusieurs récipients remplis d’un ou plusieurs des ingrédients des compositions pharmaceutiques de l’invention. Éventuellement associé à un tel récipient (s) est un avis en la forme prescrite par une agence gouvernementale réglementant la fabrication, l’utilisation ou la vente de produits pharmaceutiques ou biologiques, laquelle notice reflète l’approbation par l’agence de la fabrication, l’utilisation ou la vente pour l’administration humaine. Dans une forme de réalisation préférée, le kit contient un agent anti-viral de l’invention, par exemple, un anticorps spécifique pour les polypeptides codés par une séquence nucléotidique de SEQ ID NO: 1 ou 10, ou comme montré dans SEQ ID NO: 2-9, 59 , ou 11 à 19, ou de tout épitope hEbola, ou un polypeptide ou une protéine de la présente invention, ou une molécule d’acide nucléique de l’invention, seul ou en combinaison avec des adjuvants, des antiviraux, des antibiotiques, des analgésiques, les bronchodilatateurs, ou d’autres excipients pharmaceutiquement acceptables, .

La présente invention englobe en outre des kits comprenant un récipient contenant une composition pharmaceutique de la présente invention et des instructions pour l’utilisation.

Les essais de détection

La présente invention fournit un procédé pour détecter un anticorps qui se lie de manière immunospécifique à la hEbola virus, dans un échantillon biologique, y compris par exemple le sang, le sérum, le plasma, la salive, l’urine, les selles, etc, à partir d’un patient souffrant d’une infection hEbola, et / ou de la fièvre hémorragique. Dans un mode de réalisation spécifique, le procédé comprenant la mise en contact de l’échantillon avec le virus hEbola, par exemple, le numéro d’accès de dépôt 200706291, ou ayant une séquence d’acide nucléique génomique de la SEQ ID NO: 1 ou 10, directement immobilisé sur un substrat et en détectant la virus-anticorps lié directement ou indirectement par un anticorps anti-isotype hétérologue marqué. Dans un autre mode de réalisation spécifique, l’échantillon est mis en contact avec une cellule hôte qui est infectée par le virus hEbola, par exemple, de dépôt Accession n ° 200706291, ou ayant une séquence génomique d’acide nucléique de SEQ ID NO: 1 ou 10, et la borne anticorps est éventuellement détecté par immunofluorescence.

Un exemple de procédé pour détecter la présence ou l’absence d’un polypeptide ou d’acide nucléique de l’invention dans un échantillon biologique implique l’obtention d’un échantillon biologique provenant de diverses sources et mise en contact de l’échantillon avec un composé ou un agent capable de détecter un épitope ou un acide nucléique (par exemple, , ARNm, ADN génomique) du virus hEbola telle sorte que la présence du virus hEbola est détectée dans l’échantillon. Un agent préféré pour détecter l’ARNm ou hEbola ARN génomique de l’invention est une sonde d’acide nucléique marquée capable de s’hybrider à l’ARNm ou l’ARN génomique codant pour un polypeptide de l’invention. La sonde d’acide nucléique est, par exemple, une molécule d’acide nucléique comprenant la séquence nucléotidique de SEQ ID NO: 1 ou 10, en complément de celui-ci, ou une partie de celui-ci, tel qu’un oligonucleotide d’au moins 15, 20, 25, 30, 50, 100, 250, 500, 750, 1000 ou plus de nucleotides contigus de longueur et suffisant pour s’hybrider spécifiquement dans des conditions stringentes à un ARNm ou d’ARN génomique hEbola.

Tel qu’il est utilisé ici, le terme « conditions stringentes » décrit des conditions d’hybridation et de lavage dans lesquelles des séquences nucléotidiques présentant au moins 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, ou 95% d’identité avec l’autre restent typiquement hybridées l’une à l’autre. De telles conditions d’hybridation sont décrites dans, par exemple, mais sans s’y limiter, Current Protocols in Molecular Biology, John Wiley & Sons, New York (1989), 6.3.1 6.3.6; Méthodes de base en biologie moléculaire, Elsevier Science Publishing Co., Inc., New York (1986), pp 75 78 et 84 87; et Molecular Cloning, Cold Spring Harbor Laboratory, New York (1982), pages 387 389, et sont bien connus de l’homme de l’art. Un, exemple non limitatif préféré de conditions d’hybridation stringentes est une hybridation dans 6 x citrate de sodium / chlorure de sodium (SSC), 0,5% de SDS à environ 68 ° C suivi par un ou plusieurs lavages dans 2 x SSC, 0,5% SDS à manger température. Un autre exemple non limitatif préféré de conditions d’hybridation stringentes est une hybridation dans 6 x SSC à environ 45 ° C suivi par un ou plusieurs lavages dans 0,2 x SSC, 0,1% SDS à 50 à 65 ° C.

Une sonde d’acide nucléique, polynucléotide, oligonucléotide, ou un autre acide nucléique sont de préférence purifiés. Une séquence nucléotidique «isolé» ou «purifié» est sensiblement exempte de matériau cellulaire ou autres protéines contaminantes de la source cellulaire ou tissulaire à partir de laquelle le nucléotide est dérivé, ou est essentiellement exempte de précurseurs chimiques ou d’autres produits chimiques quand elle est synthétisée chimiquement. L’expression « pratiquement dépourvue de matière cellulaire» inclut des préparations d’un nucléotide / oligonucléotide dans lequel le nucléotide / oligonucléotide est séparée des composants cellulaires des cellules à partir desquelles elle est isolée ou produite. Ainsi, un nucléotide / oligonucléotide qui est essentiellement exempte de matériau cellulaire comprend des préparations de la nucléotidique ayant moins d’environ 30%, 20%, 10%, 5%, 2,5%, ou 1% (en poids sec) de matières contaminantes. Lorsque nucléotide / oligonucléotide est produite par synthèse chimique, elle est de préférence sensiblement exempt de précurseurs chimiques ou d’autres produits chimiques, c’est à dire qu’elle est séparée des précurseurs chimiques ou d’autres produits chimiques qui sont impliqués dans la synthèse de la protéine. En conséquence, ces préparations de la nucléotide / oligonucléotide ont moins d’environ 30%, 20%, 10%, ou 5% (en poids sec) de précurseurs ou d’autres composés que le nucléotide / oligonucléotide d’intérêt chimiques. Dans un mode de réalisation préféré de la présente invention, le nucléotide / oligonucléotide est isolé ou purifié.

Dans un autre mode de réalisation préféré spécifique, la présence de virus hEbola est détecté dans l’échantillon par une réaction de transcription inverse en chaîne par polymérase (RT-PCR) en utilisant les amorces qui sont construits sur la base d’une séquence nucléotidique partielle du génome du virus hEbola, par exemple, que le numéro d’accès de dépôt 200706291, ou ayant une séquence d’acide nucléique génomique de la SEQ ID NO: 1. ou 10 Dans un mode de réalisation particulier non limitatif, les amorces préférées pour être utilisées dans une méthode de RT-PCR sont les amorces sont décrites en détail le présent mémoire.

En mode de réalisation préféré spécifique, la présente invention fournit un test de PCR quantitative en temps réel pour détecter la présence de virus hEbola dans un échantillon biologique en soumettant l’ADNc obtenu par transcription inverse de l’ARN total extrait à partir de l’échantillon de réactions de PCR en utilisant l’spécifique amorces décrites en détail ici, et un colorant de fluorescence, tels que le SYBR ® Green I, qui fluoresce lorsqu’il est lié de manière non spécifique à l’ADN double brin. Les signaux de fluorescence provenant de ces réactions sont capturées à l’issue des étapes d’extension en tant que produit de PCR est généré sur une gamme de cycles thermiques, permettant ainsi la détermination quantitative de la charge virale dans l’échantillon basé sur une courbe d’amplification.

Un agent préféré pour détecter hEbola est un anticorps qui se lie spécifiquement à un polypeptide de l’invention ou de tout épitope hEbola, de préférence un anticorps avec un marqueur détectable. Les anticorps sont des anticorps polyclonaux à titre d’exemple, ou plus préférablement, monoclonaux. Un anticorps intact, ou un fragment de celui-ci (par exemple, Fab ou F (ab ‘) 2 ) est utilisable ici.

Le terme «marqué», en ce qui concerne la sonde ou l’anticorps, est destiné à englober un marquage direct de la sonde ou de l’anticorps par couplage (c’est à dire, liaison physique) d’une substance détectable à la sonde ou à l’anticorps, éventuellement par l’intermédiaire d’un segment de liaison, ainsi que le marquage indirect de la sonde ou de l’anticorps par réactivité avec un autre réactif qui est directement marqué. Des exemples de marquage indirect comprennent la détection d’un anticorps primaire utilisant un anticorps secondaire marqué par fluorescence et le marquage terminal d’une sonde d’ADN avec de la biotine de telle sorte qu’elle peut être détectée avec de la streptavidine marquée par fluorescence. Procédé de détection selon l’invention est éventuellement utilisé pour détecter l’ARNm, la protéine (ou de tout epitope), ou l’ARN génomique dans un échantillon in vitro ainsi que in vivo. Des exemples de techniques in vitro pour la détection de l’ARNm comprennent des hybridations du Nord, dans hybridations in situ, RT-PCR, et la protection de RNase. Les techniques in vitro pour la détection d’un épitope de hEbola A titre d’illustration comprennent des analyses par immunosorbant lié à une enzyme (ELISA), des transferts Western, des immunoprécipitations et immunofluorescence. Les techniques in vitro pour la détection de l’ARN génomique comprennent hybridations Nord, RT-PCT et protection à la RNase. En outre, les techniques in vivo pour la détection de hEbola comprennent l’introduction dans un organisme sujet un anticorps marqué dirigé contre le polypeptide. Dans un mode de réalisation, l’anticorps est marqué avec un marqueur radioactif dont la présence et l’emplacement dans le sujet organisme est détectée par des techniques d’imagerie standard, y compris une autoradiographie.

Dans un mode de réalisation spécifique, les procédés comprennent en outre l’obtention d’un échantillon témoin provenant d’un sujet témoin, la mise en contact de l’échantillon témoin avec un composé ou agent capable de détecter hEbola, par exemple, un polypeptide de l’invention ou de l’ARNm ou de l’ARN génomique codant pour un polypeptide de l’invention , de telle sorte que la présence de hEbola ou du polypeptide ou de l’ARNm ou de l’ARN génomique codant pour le polypeptide est détecté dans l’échantillon, et la comparaison de l’absence de hEbola ou du polypeptide ou de l’ARNm ou de l’ARN génomique codant pour le polypeptide dans l’échantillon témoin avec la présence de hEbola , ou du polypeptide ou de l’ARNm ou l’ADN génomique codant pour le polypeptide dans l’échantillon d’essai.

L’invention englobe également des kits pour détecter la présence de hEbola ou un polypeptide ou un acide nucléique de l’invention dans un échantillon d’essai. Le kit comprend de manière illustrative un composé marqué ou un agent capable de détecter hEbola ou le polypeptide ou une molécule d’acide nucléique codant pour le polypeptide dans un échantillon d’essai et, dans certains modes de réalisation, un moyen pour déterminer la quantité de polypeptide ou d’ARNm dans l’échantillon (par exemple, , un anticorps qui se lie au polypeptide ou une sonde oligonucléotidique qui se lie à l’ADN ou de l’ARNm codant pour le polypeptide). Les kits comprennent éventuellement des instructions d’utilisation.

Pour les kits à base d’anticorps, le kit comprend de manière illustrative: (1) un premier anticorps (par exemple, attaché à un support solide) qui se lie à un polypeptide de l’invention ou hEbola épitope; et, facultativement, (2) un second anticorps, qui se lie à différentes soit le polypeptide ou le premier anticorps et est de préférence conjugué à un agent détectable.

Pour les kits à base d’oligonucléotides, le kit comprend de manière illustrative: (1) un oligonucleotide, par exemple un oligonucleotide marqué de façon détectable, qui s’hybride à une séquence d’acide nucléique codant pour un polypeptide de l’invention ou à une séquence dans le génome hEbola; ou (2) une paire d’amorces utiles pour amplifier une molécule d’acide nucléique contenant une séquence hEbola. Ce kit comprend éventuellement un agent tampon, un conservateur ou un agent stabilisant des protéines. Ce kit comprend éventuellement des composants nécessaires pour détecter l’agent détectable (par exemple, une enzyme ou un substrat). La trousse contient éventuellement un échantillon témoin ou une série d’échantillons de contrôle qui peut être analysée et comparée à l’échantillon de test contenue. Chaque composant du kit est habituellement enfermé dans un conteneur individuel et tous les divers récipients sont dans un emballage unique avec des instructions pour l’utilisation.

Essais de criblage pour identifier des agents antiviraux

L’invention propose des procédés pour l’identification d’un composé qui inhibe la capacité du virus à infecter hEbola un hôte ou une cellule hôte. Dans certains modes de réalisation, l’invention fournit des méthodes pour l’identification d’un composé qui réduit la capacité du virus à se répliquer dans hEbola un hôte ou une cellule hôte. Toute technique bien connue de l’homme du métier est à titre d’exemple utilisé pour dépister un composé utile pour supprimer ou réduire la capacité du virus à infecter hEbola un hôte et / ou à se répliquer dans un hôte ou une cellule hôte.

Dans certains modes de réalisation, l’invention fournit des méthodes pour l’identification d’un composé qui inhibe la capacité du virus à se répliquer dans hEbola un mammifère ou une cellule de mammifère. Plus précisément, l’invention propose des procédés pour l’identification d’un composé qui inhibe la capacité du virus à infecter hEbola un mammifère ou une cellule de mammifère. Dans certains modes de réalisation, l’invention fournit des méthodes pour l’identification d’un composé qui inhibe la capacité du virus à se répliquer dans hEbola une cellule de mammifère. Dans un mode de réalisation spécifique, la cellule de mammifère est une cellule humaine.

Dans un autre mode de réalisation, une cellule est mise en contact avec un composé d’essai et infectée par le virus hEbola. Dans certains modes de réalisation, une culture témoin est infecté par le virus hEbola en l’absence d’un composé d’essai. La cellule est éventuellement mis en contact avec un composé à tester avant, simultanément avec, ou après l’infection par le virus hEbola. Dans un mode de réalisation particulier, la cellule est une cellule de mammifère. Dans un mode de réalisation encore plus spécifique, la cellule est une cellule humaine. Dans certains modes de réalisation, la cellule est incubée avec le composé d’essai pendant au moins 1 minute, 5 minutes au moins, au moins 15 minutes, au moins 30 minutes, au moins 1 heure, au moins 2 heures, au moins 5 heures, au moins 12 heures, ou d’au moins 1 jour. Le titre du virus est éventuellement mesuré à n’importe quel moment au cours de l’essai. Dans certains modes de réalisation, une évolution temporelle de la croissance virale dans la culture est déterminée. Si la croissance virale est inhibée ou réduite en présence du composé d’essai, le composé d’essai est identifié comme étant efficaces dans l’inhibition ou la réduction de la croissance ou l’infection du virus hEbola. Dans un mode de réalisation spécifique, le composé qui inhibe ou réduit la croissance du virus hEbola est testé pour sa capacité à inhiber ou à réduire le taux d’autres virus pour tester sa spécificité pour le virus hEbola de croissance.

Dans un mode de réalisation, un composé d’essai est administré à un animal modèle et le modèle animal est infecté par le virus hEbola. Dans certains modes de réalisation, un modèle animal de contrôle est infecté par le virus hEbola sans l’administration d’un composé d’essai. Le composé d’essai est éventuellement administré avant, simultanément avec, ou après l’infection par le virus hEbola. Dans un mode de réalisation particulier, le modèle animal est un mammifère. Dans un mode de réalisation encore plus spécifique, le modèle animal est, mais n’est pas limité à, un rat du coton, d’une souris, ou un singe. Le titre du virus dans le modèle animal est éventuellement mesuré à n’importe quel moment au cours de l’essai. Dans certains modes de réalisation, une évolution temporelle de la croissance virale dans la culture est déterminée. Si la croissance virale est inhibée ou réduite en présence du composé d’essai, le composé d’essai est identifié comme étant efficaces dans l’inhibition ou la réduction de la croissance ou l’infection du virus hEbola. Dans un mode de réalisation spécifique, le composé qui inhibe ou réduit la croissance de la hEbola dans le modèle animal est testé pour sa capacité à inhiber ou à réduire le taux d’autres virus pour tester sa spécificité pour le virus hEbola de croissance.

Selon le procédé de l’invention, un être humain ou un animal est éventuellement traité pour pour EboBun ou EboIC, autre infection virale ou une infection bactérienne par administration d’une quantité efficace d’une composition thérapeutique selon l’invention. De préférence, un vaccin est administré à titre prophylactique. Une «quantité efficace» est une quantité qui va induire une réponse immunitaire chez un sujet. A titre d’exemple, une quantité efficace des compositions de la présente invention varie de l’ordre du nanogramme / kg en milligramme / kg montants pour les jeunes enfants et les adultes. Des doses équivalentes pour les poids légers ou plus lourds corps peuvent être facilement déterminées. La dose doit être ajustée en fonction de l’individu à qui la composition est administrée et variera avec l’âge, le poids et le métabolisme de l’individu. La quantité exacte de la composition requise variera d’un sujet à l’autre, selon l’espèce, l’âge, le poids et l’état général du sujet, le peptide ou le polypeptide particulier utilisé, de son mode d’administration et analogues. Une quantité appropriée peut être déterminée par l’homme de l’art en utilisant seulement une expérimentation de routine compte tenu des présents enseignements. L’homme du métier comprendra que les dosages sont le mieux optimisées par le médecin pratiquant ou vétérinaire et des procédés pour la détermination des quantités de doses et schémas posologiques et de la préparation de formes posologiques sont décrits, par exemple, dans Pharmaceutical Sciences de Remington, (Martin, EW, ed., Le dernier édition), Mack Publishing Co., Easton, Pa. De préférence, une administration unique est utilisable pour induire une réponse immunitaire.

Des procédés impliquant des techniques biologiques classiques sont décrits ici. Ces techniques sont généralement connus dans l’art et sont décrits en détail dans les traités de méthodologie tels que Molecular Cloning: A Laboratory Manual, 2nd ed, vol.. 1-3, éd. . Sambrook et al, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; et Current Protocols in Molecular Biology, éd. Ausubel et al., Greene Publishing et Wiley-Interscience, New York, 1992 (avec mises à jour périodiques). Méthodes immunologiques (par exemple, la préparation d’anticorps spécifiques de l’antigène, immunoprécipitation et immunoblot) sont décrits, par exemple, dans Current Protocols in Immunology, éd. . Coligan et al, John Wiley & Sons, New York, 1991; et les méthodes d’analyse immunologique, éd. Masseyeff et al., John Wiley & Sons, New York, 1992.

Des modes de réalisation de compositions de l’invention et les méthodes sont illustrées dans les exemples détaillés suivants. Ces exemples sont fournis à titre d’illustration et ne sont pas considérés comme des limitations sur la portée de l’invention des compositions et des procédés.

EXEMPLESExemple 1Nouvellement découvert le virus Ebola associée à une fièvre hémorragique Foyer de Bundibugyo, en Ouganda

À la fin de Novembre 2007 cas HF ont été signalés dans les cantons de Bundibugyo et Kikyo dans le district de Bundibugyo, en Ouganda occidental (Figue. 1A). Ces échantillons ont été analysés comme décrit par Towner, JS, et al. PLoS Pathog, 2008 Novembre; 4 (11): e1000212, les contenus sont incorporés ici par référence pour les méthodes, les résultats, les réactifs et tous les autres aspects de la publication. Un total de 29 échantillons de sang ont été recueillis initialement sur ​​des cas suspects et a montré des signes d’infection de virus Ebola aiguë dans huit échantillons en utilisant un test antigène du virus Ebola de capture large réactivité connu une réaction croisée avec les différentes espèces de virus Ebola »et un essai de capture IgM basés sur le Zaïre du virus Ebola réactifs (tableau 1). Ces échantillons ont été négatifs lorsqu’elle est initialement testé avec en temps réel analyses RT-PCR très sensibles spécifiques pour tous les ebolaviruses et marburgviruses connus Zaïre et le Soudan. Cependant, une autre preuve de l’infection par le virus Ebola aiguë a été obtenue en utilisant un traditionnellement moins sensibles (par rapport au temps réel dosages RT-PCR), mais filovirus L essai de RT-PCR spécifique d’un gène de façon plus générale réactif (1 échantillon) (tableau 1). L’analyse de séquence du fragment de PCR (400 pb du gène L du virus) a révélé la raison de l’échec initial des dosages par RT-PCR en temps réel, en tant que la séquence était distincte de celle des quatre espèces connues de virus Ebola, bien que lointainement apparenté Côte d’Ivoire virus Ebola. Au total, 9 des 29 échantillons présentaient des signes d’infection de virus Ebola, et tous les tests se sont révélés négatifs pour Marburg (données non présentées).

Environ 70% du génome du virus a été séquencé rapidement à partir d’ARN total extrait à partir d’un sérum du patient (# 200706291) en utilisant une méthode métagénomique de pyroséquençage nouvellement créé (454 Life Sciences) qui implique des cycles successifs de hasard amplification de l’ADN 8 . Utilisation du projet de nouvelle séquence dérivée, en temps réel RT-PCR test spécifique pour le gène NP de ce virus a été rapidement développé et évalué. Le dosage a été démontré qu’ils ont une excellente sensibilité (tableau 1), en trouvant tous les positifs initiaux six échantillons qui se sont avérés positifs par l’une capture d’antigène viral (cinq échantillons) ou des essais d’isolement du virus (quatre échantillons). La capture d’antigène, IgM, IgG et des tests de PCR en temps réel nouvellement conçus ont été rapidement transférés au virus de l’Institut ougandais de recherche au cours de l’épidémie de faciliter l’identification rapide et l’isolement des cas d’Ebola dans la zone touchée pour un contrôle efficace de l’épidémie . L’épidémie a continué jusqu’à la fin Décembre 2007 et a donné lieu à 149 cas suspects et 37 décès 9 .

Tableau 1. Résultats du diagnostic de virus Ebola premiers 29 échantillons obtenus de district de Bundibugyo avec des numéros d’échantillons numériques attribuées. RT-PCR se réfère aux résultats obtenus à partir de la PCR classique en utilisant les amorces largement réactives filo-A / B 13 . Ag, IgM, IgG et se réfèrent à des résultats de tests basés sur ELISA 10, 11 avec le Zaïre du virus Ebola réactifs tandis que l’isolement du virus se réfère à des tentatives de culture sur cellules Vero E6 » 2 . Q-RT-PCR se réfère aux résultats obtenus à l’aide en temps réel test spécifique optimisée Ebola Bundibugyo RT-PCR avec seuil de cycle (CT) des valeurs d’échantillons positifs (Pos) indiqués dans la colonne de droite. * Echantillon # 200706291 est l’échantillon clinique dont prototype isoler # 811250 a été obtenu.

TABLEAU 1
Échantillon RT- Virus Q-RT-
Non. PCR Ag IgM IgG Isolement PCR Ct
200706288 neg neg neg neg neg neg 40
200706289 neg neg neg neg neg neg 40
200706290 neg neg neg neg neg neg 40
200706291 * Pos Pos neg neg Pos Pos 23.64
200706292 neg neg neg neg neg neg 40
200706293 neg neg neg neg neg neg 40
200706294 neg neg neg neg neg neg 40
200706295 neg neg neg neg neg neg 40
200706296 neg neg Pos Pos neg neg 40
200706297 neg neg Pos Pos neg neg 40
200706298 neg Pos Pos Pos neg Pos 34.83
200706299 neg neg Pos Pos neg neg 40
200706300 neg neg neg neg neg neg 40
200706301 neg neg neg neg neg neg 40
200706302 neg Pos Pos neg neg Pos 35.01
200706303 neg neg neg neg neg neg 40
200706304 neg neg neg neg Pos Pos 38.18
200706305 neg neg neg neg neg neg 40
200706306 neg neg neg neg neg neg 40
200706307 neg neg neg neg neg neg 40
200706320 ND Pos neg neg Pos Pos 30.24
200706321 ND neg neg neg neg neg 40
200706322 ND neg neg neg neg neg 40
200706323 ND neg neg neg neg neg 40
200706324 ND neg neg neg neg neg 40
200706325 ND neg neg neg neg neg 40
200706326 ND neg neg neg neg neg 40
200706327 ND Pos neg neg Pos Pos 34.41
200706328 ND neg neg neg neg neg 40

La séquence du génome entier du virus a été réalisée en utilisant une approche classique de amorce de séquençage de marche sur l’ARN. Le génome complet de l’Ebola Eb n’était pas disponible, il a été trop tirée par une combinaison similaire de pyroséquençage et amorce la marche des approches amorcées aléatoires. L’acquisition de ces séquences autorisées pour la première fois l’analyse phylogénétique des génomes complets de représentants de toutes les espèces connues de virus Ebola et Marburg. L’analyse a révélé que le virus nouvellement découvert diffère des quatre espèces de virus Ebola existants (Figue. 1), Avec environ 32% de nucleotides à partir de la différence, même le parent le plus proche, EboIC (tableau 2). Semblable divergence du génome complet (35-45%) est observée entre les espèces de virus Ebola précédemment caractérisées.

. Tableau 2 matrice d’identité basée sur des comparaisons de pleine longueur séquences génomiques du Zaïre ebolaviruses 1976 (numéro d’accession Genbank NC 002 549) et 1995 (numéro d’accession Genbank AY354458), Soudan Ebola 2000 (numéro d’accession Genbank NC 006432), Côte d ‘ Ivoire ebolavirus 1994 (SEQ ID NO: 10), Reston du virus Ebola 1989 (numéro d’accession Genbank NC 004161), et Bundibugyo ebolavirus 2007 (SEQ ID NO: 1).

TABLEAU 2
Zaïre Soudan EboIC EboBun Reston
’95 ’00 94 ’07 89
Zaïre ’76 0,988 .577 0,630 .632 0,581
Zaïre ’95 .577 .631 0,633 0,581
Soudan ’00 .577 .577 .609
EboIC ’94 0,683 0,575
EboBun ’07 .576

Le matériel et l’information obtenue à partir de la découverte de la nouvelle EboBun de virus unique et la réalisation qui, avec EboIC ces virus représentent une clairière d’espèces de virus Bundibungyo-Côte d’Ivoire Ebola est précieux, et rend possible le développement d’outils cliniques, diagnostiques et de recherche dirigée hEbola à l’infection humaine.

Matériel et méthodes

Ebola détection et isolement du virus.

Plusieurs techniques de diagnostic ont été utilisés pour chaque échantillon: dosages (i) l’antigène de capture, IgG, et IgM ont été réalisées comme décrit précédemment 11 (ii) les tentatives d’isolement du virus ont été réalisés sur des cellules Vero E6 de 2 et surveillées pendant 14 jours; (Iii) l’ARN a été extrait et testé pour le Zaïre 16 et le Soudan du virus Ebola et Marburg 4 en utilisant des tests de RT-PCR quantitatives en temps réel visant à détecter toutes les espèces connues de chaque espèce de virus respectifs les amorces / sonde pour l’analyse de virus Ebola Soudan étaient EboSudBMG 1 ( +) 5′-ATG GCC GIT TCA GGT TTG AG-3 ‘(SEQ ID NO: 21), EboSudBMG 1 (-) 5′-GGT IAC ATT GGG CAA CAA TTC A-3’ (SEQ ID NO: 22) et Ebola Soudan BMG sonde 5’FAM-AC GGT GCA CAT TCT CCT TTT GGA CTC-BHQ1 (SEQ ID NO: 23)]; (Iv) la RT-PCR conventionnelle a été réalisée avec l’amorce filo A / B défini comme précédemment décrit 16 en utilisant Superscript III (Invitrogen) selon les instructions du fabricant. La 200706291 spécimen a été choisi comme échantillon de référence pour une analyse supplémentaire de la séquence.

Séquençage du génome.

Pyroséquençage a été réalisée en utilisant l’approche développée par 454 Life Sciences, et la méthode décrite par Cox-Foster et al. 8 virus Après génome entier amorce la marche a été effectuée comme décrit précédemment 17 , mais en utilisant des amorces spécifiques pour l’amplification du virus Ebola Bundibugyo RT-PCR. Au total, le génome du virus entier a été amplifié en six fragments de RT-PCR se chevauchant (toutes les amorces énumérés de 5 ‘à 3’): Le fragment A (prédite taille de 2,7 kb) a été amplifié en utilisant de l’avant-GTGAGACAAAGAATCATTCCTG (SEQ ID NO: 24) avec marche arrière CATCAATTGCTCAGAGATCCACC-(SEQ ID NO: 25); fragment B (taille prédite 3,0 kb) a été amplifié en utilisant de l’avant-CCAACAACACTGCATGTAAGT (SEQ ID NO: 26) avec inversion de AGGTCGCGTTAATCTTCATC (SEQ ID NO: 27); fragment C (taille prévue de 3,5 kb) a été amplifié en utilisant de l’avant-GATGGTTGAGTTACTTTCCGG (SEQ ID NO: 28) avec inversion de GTCTTGAGTCATCAATGCCC (SEQ ID NO: 29); fragment D (taille prédite de 3,1 kb) a été amplifié en utilisant de l’avant-CCACCAGCACCAAAGGAC (SEQ ID NO: 30) avec inversion de CTATCGGCAATGTAACTATTGG (SEQ ID NO: 31); fragment E (taille prévue de 3,4 kb) a été amplifié en utilisant l’avant-GCCGTTGTAGAGGACACAC (SEQ ID NO: 32) avec rétro-CACATTAAATTGTTCTAACATGCAAG (SEQ ID NO: 33) et le fragment F (prévue taille de 3,5 kb) a été amplifié en utilisant l’avant-CCTAGGTTATTTAGAAGGGACTA (SEQ ID n ° 34) avec rétro-GGT AGA TGT ATT GAC CAG AAT ATC (SEQ ID NO: 35).

Les exacts 5 ‘et 3’ de Bundibugyo ebolavirus ont été déterminées par la RACE 3 ‘de l’ARN viral extrait des infectées par un virus Vero E6 monocouches de cellules en utilisant le réactif d’isolement de TriPure. ARN ont ensuite été polyadénylés in vitro en utilisant A-Plus de poly (A) de kit de résidus de la polymérase (Biotechnologies Epicenter) en suivant les instructions du fabricant et ensuite purifiés en utilisant un kit RNeasy (Qiagen) en suivant les protocoles standards. Dix microlitres d’ARN polyadénylé in vitro ont été ajoutés en tant que matrice dans des réactions de RT-PCR, en utilisant le système RT-PCR One-Step SuperScript III avec Platinum Taq High Fidelity (Invitrogen) selon le protocole du fabricant. Deux réactions parallèles RT-PCR en utilisant l’oligo (dT)-3’RACE contenant AP-amorce (Invitrogen) en mélange avec une des deux amorces spécifiques virales, Ebo U-692 (-) ACAAAAAGCTATCTGCACTAT (SEQ ID NO: 36) et Ebo- V18269 (+) CTCAGAAGCAAAATTAATGG (SEQ ID NO: 37), généré ~ 700 nt de long fragments contenant les extrémités 3 ‘des ARN génomiques et antigénomiques navigateur. Les produits de RT-PCR résultants ont été analysés par électrophorèse sur agarose, et des bandes d’ADN de la taille correcte ont été purifiés en utilisant le kit QIAquick Gel Extraction (Qiagen) et séquences en utilisant des protocoles standards (ABI).

La séquence nucléotidique de l’Ebola Côte d’Ivoire (EboIC) isoler l’ARN a été initialement déterminé en utilisant la même stratégie exacte de pyroséquençage que celui utilisé pour Bundibugyo Ebola décrit ci-dessus. Cette méthode séquence générée pour environ 70% de la totalité du génome. Cette ébauche de la séquence a ensuite été utilisé pour concevoir un ensemble amorce stratégie de marche du génome pour combler les lacunes et de confirmer la séquence initiale. Côte d’Ivoire amorces spécifiques du virus Ebola suivantes ont été utilisées pour produire des fragments de RT-PCR, désigné AF, comme suit: Fragment A (taille prévue de 3,0 kb) a été amplifié en utilisant l’avant-GTGTGCGAATAACTATGAGGAAG (SEQ ID NO: 38) et arrière-GTCTGTGCAATGTTGATGAAGG (SEQ ID NO: 39); Fragment B (taille prévue de 3,2 kb) a été amplifié en utilisant de l’avant-CATGAAAACCACACTCAACAAC (SEQ ID NO: 40) et inverse-GTTGCCTTAATCTTCATCAAGTTC (SEQ ID NO: 41); Fragment C (taille prédite 3,0 kb) a été amplifié en utilisant de l’avant-GGCTATAATGAATTTCCTCCAG (SEQ ID NO: 42) et inverse-CAAGTGTATTTGTGGTCCTAGC (SEQ ID NO: 43); fragment D (taille prédite de 3,5 kb) a été amplifié en utilisant de l’avant-GCTGGAATAGGAATCACAGG (SEQ ID NO: 44) et inverse-CGGTAGTCTACAGTTCTTTAG (SEQ ID NO: 45); fragment E (taille prédite 4,0 kb) a été amplifié en utilisant de l’avant-GACAAAGAGATTAGATTAGCTATAG (SEQ ID NO: 46) et inverse-GTAATGAGAAGGTGTCATTTGG (SEQ ID NO: 47); fragment F (prévue taille de 2,9 kb) a été amplifié en utilisant l’avant-CACGACTTAGTTGGACAATTGG (SEQ ID NO: 48) et arrière-CAGACACTAATTAGATCTGGAAG (SEQ ID NO: 49); fragment G (taille prévue de 1,3 kb) a été amplifié en utilisant de l’avant-CGGACACACAAAAAGAAWRAA (SEQ ID NO: 50) et inverse-CGTTCTTGACCTTAGCAGTTC (SEQ ID NO: 51); et le fragment H (taille prédite de 2,5 kb) a été amplifié en utilisant de l’avant-GCACTATAAGCTCGATGAAGTC (SEQ ID NO: 52) et inverse-TGGACACACAAAAARGARAA (SEQ ID NO: 53). Un écart dans le contig de séquence était située entre les fragments C et D, et cela a été résolu en utilisant les amorces suivantes pour générer un fragment prédite de 1,5 kb: avant-CTGAGAGGATCCAGAAGAAAG (SEQ ID NO: 54) et inverse-GTGTAAGCGTTGATATACCTCC (SEQ ID NO: 55 ). Le terminal ~ 20 nucléotides de la séquence n’a pas été déterminée expérimentalement, mais ont été déduite par comparaison avec les autres séquences du génome d’Ebola connus.

Real-Time RT-PCR Bundibugyo virus Ebola.

Les amorces et la sonde utilisées dans l’analyse Q-RT-PCR spécifique du virus Ebola Bundibugyo ont été les suivants: EboU965 (+): 5′-GAGAAAAGGCCTGTCTGGAGAA-3 ‘(SEQ ID NO: 56), EboU1039 (-): 5’-TCGGGTATTGAATCAGACCTTGTT- 3 ‘(SEQ ID NO: 57) et EboU989 Prb: 5’Fam-TTCAACGACAAATCCAAGTGCACGCA-3’BHQ1 (SEQ ID N ° 58). Réactions Q-RT-PCR ont été établies en utilisant Superscript III One-Step RT-Q-PCR (Invitrogen) selon les instructions du fabricant et fonctionnent pendant 40 cycles avec une température de 58 ° C de recuit.

Analyse phylogénétique.

Modeltest 3.7 18 a été utilisé pour examiner 56 modèles de substitution de nucléotides afin de déterminer le modèle le plus approprié pour les données. Le modèle réversible Durée général incorporant des sites invariants et une distribution gamma (GTR + I + G) a été sélectionné à l’aide du critère d’information d’Akaike (AIC). Fréquences nucléotidiques sont A = 0,3278, C = 0,2101, G = 0,1832, T = 0,2789, la proportion de sites invariants = 0,1412, et le paramètre de forme gamma = 1,0593. Une analyse du maximum de vraisemblance a ensuite été effectuée dans PAUP * 4.0b10 19 utilisant le GTR + I + G paramètres du modèle. Valeurs de support bootstrap ont été utilisés pour évaluer le soutien topologique et ont été calculées sur la base de 1000 pseudoreplicates 20 .

En outre, une analyse phylogénétique a été réalisée en bayésienne MrBayes 3,221 à l’aide du GTR + I + G modèle de substitution nucléotidique. Deux analyses simultanées, chacune avec quatre chaînes de Markov, ont été exécutés pour 5.000.000 générations d’échantillonnage 100 générations. Avant la fin de la course, le module Awty a été utilisé pour évaluer chaîne de Markov convergence de Monte Carlo pour assurer que la durée de l’analyse était suffisante 22 . Arbres générés avant la stabilisation des scores de probabilité ont été rejetées (brûler dans = 40), et les arbres restants ont été utilisés pour construire un arbre de consensus. Support nodal a été évaluée par les valeurs de probabilité postérieure (> = 95 de soutien statistique).

Exemple 2La vaccination contre EboBun

Pour déterminer la capacité d’immunogènes pour elict une réponse immunitaire chez les primates non humains (PNH), 12 macaques cynomolgus, dont 10 sont immunisés avec VSVΔG / EboBunGP oralement (OU n = 4), par voie intranasale (IN, n = 4 ) ou intramusculaire (IM, n = 2) en conformité avec toutes les directives de contrôle et de sécurité des animaux et essentiellement comme décrit par Qiu, X, et al, PLoS ONE.. 2009; 4 (5): e5547. Les deux animaux témoins restants sont vaccinés par voie intramusculaire avec VSVΔG / MARVGP. VSVΔG / MARVGP n’offre pas une protection hétérologue contre EboBun donc ces PSN succombent à l’infection EboBun. Les animaux sont acclimatés pendant 14 jours avant l’infection. Les animaux sont nourris et surveillés deux fois par jour (pré-et post-infection) et nourris singe chow commerciale, des friandises et des fruits. Enrichissement élevage se compose de jouets commerciaux et la stimulation visuelle.

Les vaccins recombinants VSVΔG / EboBun sont synthétisés exprimant la glycoprotéine EboBun (GP) (SEQ ID NO: 9), une glycoprotéine soluble (PSC) (SEQ ID NO: 4), ou la nucléoprotéine (NP) (SEQ ID NO: 3). Vaccins contrôle VSVΔG / de MARVGP représentent les protéines analogues du lac victoria Marburg (MARV) (souche Musoke). Les résultats suivants pour le GP sont similaires pour les SGP et NP. Les vaccins sont générés à l’aide du VSV (serotype Indiana) comme décrit précédemment. Garbutt, M, et al, J Virol, 2004.; 78 (10) :5458-5465; Schnell, MJ, et al, PNAS USA, 1996.; 93 (21) :11359-11365. Virus EboBun défi est des passages dans des cellules Vero E6 avant de contester, comme décrit précédemment Jones, SM, et al. Nat Med, 2005; 11 (7) :786-790; Jahrling, PB, et al,. J Infect Dis, 1999; 179 (Suppl 1): S224-34. Un peptide immunogène de la piscine EboBun constitué de 15mers avec des chevauchements de 11 acides aminés (Sigma-Genosys) s’étendant sur ​​la totalité de la séquence des immunogènes de la souche Mayinga EboBun et GP 1976 sont utilisés.

Douze filovirus singes cynomolgus naïfs randomisés en quatre groupes reçoivent 2 ml de 1 x 10 7 UFP / ml de vaccin dans un milieu de Eagle modifié par Dulbecco (DMEM). Les animaux dans les trois groupes expérimentaux sont vaccinés avec soit: 1) 2 ml par voie orale (OR) (n = 4); 2) 1 ml goutte à goutte dans chaque narine, par voie intranasale (IN) (n = 4); ou 3) 1 ml chacune dans deux sites par voie intramusculaire (IM) (n = 2). Les deux témoins sont injectées par voie intramusculaire avec 2 ml de 1 x 10 7 UFP / ml de VSVΔG / MARVGP. Tous les animaux sont éprouvés par voie intramusculaire 28 jours plus tard avec 1000 PFU de EboBun.

Examen de routine est effectuée sur 0, 2, 4, 6, 10, 14 et 21 jours après la vaccination, puis 0, 3, 6, 10, 14, 19, 26 jours, 6 et 9 mois après le défi EboBun. Pour les examens animaux sont anesthésiés par injection intramusculaire de 10 mg / kg de Ketaset (Ayerst). Les examens comprennent l’analyse hématologique, de la température de contrôle (rectale), le taux de respiration, les ganglions lymphatiques, le poids, l’hydratation, les décharges et les muqueuses. En outre, des prélèvements (gorge, orale, nasale, rectale, vaginale) et des échantillons de sang sont prélevés (4 ml de la veine fémorale, 1 ml dans un tube Vacutainer EDTA, 3 ml de sérum séparateur tube Vacutainer). PBMC de singe cynomolgus sont isolés au moyen de tubes Vacutainer CPT BD citrate de sodium (Becton Dickinson) selon le protocole du fabricant.

Tous VSVΔG / EboBunGP animaux immunisés sont protégés de défi à haute dose. Ces animaux ne présentent aucun signe clinique de la maladie après la vaccination ou EboBun défi. Les deux animaux témoins montrent des symptômes typiques associés à EboBun HF dont la fièvre, des éruptions maculaires, la léthargie et l’absence de réponse. Infection permanente requiert l’euthanasie. Hématologie analyse à chaque date d’examen montrent des augmentations dans la plaquette-crit dans les RUP et dans les groupes post-défi, cependant, pas de changements significatifs sont observés dans une post-vaccination PSN ou dans le VSVΔG / EboBunGP vaccinés après la provocation PSN.

EboBun la production d’anticorps de la réponse humorale à la vaccination et le défi est examiné par un virus comme test ELISA particules (VLP) sur la base. La génération d’EboBun VLP est effectuée par le protocole de ZEBOV comme décrit par Wahl-Jensen, V., et al,. J Virol, 2005; 79 (4) :2413-2419. ELISA est réalisé selon le protocole décrit par Qiu, X, et al., PLoS ONE. 2009; 4 (5): e5547.

Les animaux immunisés VSVΔG / de MARVGP ne développent pas une réponse d’anticorps détectable à EboBun. En revanche, les réponses en anticorps puissants sont détectés chez tous les animaux VSVΔG / de EboBunGP immunisés indépendants de la vaccination itinéraire. Entre les jours 14 et 21 après la vaccination, tous VSVΔG / EboBunGP immunisé PSN développer des niveaux élevés d’IgA, IgM, IgG et contre EboBunGP. Après défi les titres IgM ne dépassent pas les niveaux post-vaccination, cependant, IgG et IgA titres d’anticorps sont augmentés pic 14 jours après la provocation puis décroissant lentement avant le maintien d’un anticorps relativement élevée titre jusqu’à 9 mois.

Le niveau d’anticorps de neutralisation est détectée par un dosage EboBun-GFP par cytométrie de flux de neutralisation dans le sérum recueillis aux jours 0 et 21 après la vaccination. Les échantillons sont analysés en double exemplaire, pour leur capacité à neutraliser une infection par EboBun-GFP dans des cellules VeroE6. Des échantillons de sérum dilués en série sont incubées avec un volume égal de EboBun-GFP dans du DMEM, à 37 ° C, 5% CO2 pendant 1 heure suivi par l’addition de 150 ul par puits d’une plaque à 12 puits confluentes de cellules VeroE6 (MOI = 0,0005). Après 2 heures à 37 ° C, 5% CO 2 , 1 ml de DMEM, à 2% serym bovin fœtal (FBS), 100 U / ml de pénicilline, 100 pg / ml de streptomycine, on ajoute par puits et incubées pendant 5 jours. Les cellules sont récoltées par élimination du surnageant de culture, le lavage avec 1 ml de PBS, 0,04% d’EDTA, puis en ajoutant 800 pl de PBS 0,04% d’EDTA pendant 5 minutes à 37 ° C avant d’ajouter 8 ml de PBS, 4% de paraformaldéhyde (PFA) et une nuit incubation. Les cellules sont acquis (10 000 événements) et analysées avec CellQuest v3.3 Pro sur un cytomètre de flux Becton Dickinson cytomètre.

Le OU EN routes et produisent des anticorps neutralisants EboBunGP spécifiques à la production ou de la voie titres les plus élevés après la vaccination. La vaccination IM produit des niveaux détectables d’anticorps neutralisants. En comparaison, les trois quarts des PSN dans le groupe OR montrent une réduction de 50% dans les cellules positives EboBun-GFP à un titre de 1:40. De même, les résultats de l’itinéraire dans une réduction de cellules positives EboBun-GFP à la dilution 1:40.

Effectrices des réponses immunitaires cellulaires EboBunGP-spécifiques sont déterminées en utilisant l’IL-2 et des tests ELISPOT IFN-γ de la manière décrite par Qin, X, et al., PLoS ONE. 2009; 4 (5): e5547 afin de déterminer le nombre d’IL-2 et IFN-γ des lymphocytes sécrétant. Avant de contester les jours 10 à 14 après la vaccination, il est un EboBun réponse IFN-γ spécifiques immunogène détectable dans tous les animaux vaccinés. La voie IM est le plus puissant, induisant environ deux fois plus d’IFN-γ des cellules sécrétant que OU (p <0,001) ou IN (p = 0,043) des itinéraires. Une réponse secondaire IFN-γ post-défi fort est induite dans tous VSVΔG / EboBun animaux immunisés avec la voie IM produire les cellules plupart d’IFN-γ à jour 6. Par jour 10 montre le groupe OR une réponse plus forte. L’IFN-γ dans le groupe A augmente de façon constante, atteignant un sommet de 26 jours après la provocation avec 4,3 et 2 fois plus EboBun cellules IFN-γ spécifiques sécrétant que l’IM (p = 0,003) et OU (p = 0,075) groupe, respectivement. Tous les trois routes produisent de fortes réponses IFN-γ spécifiques EboBun.

Après la vaccination, le groupe IM a aussi plus de IL-2 des cellules sécrétant spécifique EboBunGP que l’un des groupes les muqueuses immunisés. Post-défi, la voie IM continue de dominer tôt après la provocation avec un pic au jour 10. Cette différence montre une tendance par rapport au groupe A (p = 0,067) et est significative par rapport au groupe OR (p <0,001). En outre, le groupe IN a plus de cellules IL-2 que la production ou le groupe (p = 0,090) au jour 10 après la provocation. Par jour 26 post-défi les trois voies de continuer à produire un IL-2 réponse spécifique EboBunGP, cependant, la réponse du groupe A est la plus forte. Au jour 26 après la provocation du groupe IN a le IFN-γ plus puissant et IL-2 réponses, ainsi que la plus haute IgA et IgG titre d’anticorps, indiquant l’itinéraire de vaccination, suivi d’un défi de EboBun, les résultats dans le développement de puissants et des réponses soutenues effectrices.

Nombres absolus de lymphocytes CD3 + , CD4 + , et CD8 + (cellules CD3 + 4 ) des populations de cellules T est déterminé par cytométrie de flux. Aucune diminution est observée dans les populations de lymphocytes pour l’une des VSVΔG / EboBunGP vaccinés PSN. En revanche, les animaux de contrôle qui ne sont pas protégés de EboBun montrent le nombre de lymphocytes a diminué de 28-57%.

le nombre de macrophages sont légèrement augmenté chez les animaux témoins. Cependant, le nombre de CD14 + cellules est plus grande dans les VSVΔG / EboBunGP groupes vaccinés avec la voie IM montrant les augmentations les plus importantes.

Afin de déterminer la réponse immunitaire à long terme après la provocation, CD4 EboBunGP spécifiques + et CD8 + mémoire des lymphocytes T sont examinés pour leur capacité à proliférer (CFSE ) ou de produire de l’IFN-γ en réponse à des peptides EboBunGP à 6 mois après l’ vaccination. Réponses spécifiques EboBunGP mémoire sont observés à la suite de la vaccination suivie d’un défi ZEBOV. Ces réponses persistent pendant au moins 6 mois. Les populations de mémoire en OU et dans les voies d’inoculation montrent le plus grand potentiel de prolifération et de l’IFN-γ production post-défi.

Toutes les brevets ou publications mentionnés dans cette description sont incorporés ici par référence dans la même mesure que si chaque publication individuelle est spécifiquement et individuellement indiquée pour être incorporée par référence.

Les compositions et procédés décrits ici sont actuellement représentatifs de modes de réalisation préférés, on peut citer, et ne vise pas comme des limitations de la portée de l’invention. Les modifications qui y sont et d’autres utilisations apparaîtront à l’homme de l’art. Ces modifications et d’autres utilisations peuvent être apportées sans sortir du cadre de l’invention tel que défini dans les revendications. Toutes les plages numériques sont inclus des nombres entiers et décimaux entiers entre les points de terminaison, et compris les critères d’évaluation.

Références

  • 1. Suzuki, Y., et Gojobori, T., (1997) L’origine et l’évolution du virus Ebola et Marburg. Mol Evol Bio, 14 (8): 800-806.
  • 2. Sanchez, A., Geisbert, TW, Feldmann, H. dans Fields Virology (ed. Knipe, DM, Howley, PM) 1409-1448 (Lippincott Williams & Wilkins, Philadelphie, 2007).
  • 3. Leroy, EM et al., (2005) chauves-souris frugivores que les réservoirs du virus Ebola. Nature, 438, 575-6.
  • 4. Towner, JS et al., (2007) l’infection par le virus de Marburg détecté dans une chauve-souris commune africaine. PLoS ONE, 2 (8), e764.
  • 5. Swanepoel, R. et al., (2007) Etudes des hôtes réservoirs pour le virus de Marburg. Emerg Infect Dis, 13 (12), de 1847 à 1851.
  • 6. Le Guenno, B. et al., (1995) Isolement et caractérisation partielle d’une nouvelle espèce de virus Ebola. Lancet, 345 (8960), 1271-4.
  • 7. Ksiazek, TG et al. (1999) virologie clinique de fièvre hémorragique à virus Ebola (EHF):. Virus, l’antigène du virus, IgG et IgM conclusions de chez les patients de l’EHF à Kikwit, 1995 J. Infect Dis 179 (suppl 1), S177-S187.
  • 8. Cox-Foster, DL et al. (2007) Une étude métagénomique des microbes dans le miel d’abeille désordre d’effondrement des colonies. Sciences 318, 283-7.
  • 9. Organisation mondiale de la Santé (2008) contenait épidémie d’Ebola en Ouganda. Caractéristiques, 22 Février www.who.int/features/2008/ebola_outbreak/en/.
  • 10. Sullivan, NJ, Sanchez, A., Rollin, PE, Yang, Z.-Y. & Nabel, GJ (2000) Développement d’un vaccin préventif contre l’infection par le virus Ebola chez les primates. Nature 408, 605-609.
  • 11. Ksiazek, TG, Ouest, CP, Rollin, PE, Jahrling, PB & Peters, CJ (1999) ELISA pour la détection d’anticorps dirigés contre les virus Ebola. J. Infect Dis 179 (suppl 1), S191-S198.
  • 12. Rodriguez, L. et al. (1999) sur la persistance et la stabilité génétique du virus Ebola lors de l’épidémie à Kikwit, Zaïre 1995. J. Infect Dis 179 (suppl 1), S170-S176.
  • 13. Sanchez, A. et al. Détection et la caractérisation moléculaire des virus responsables de la maladie d’Ebola chez les primates humains et non humains. J. Infect Dis 179 (suppl 1), S164-S169 (1999).
  • 14. Jones, SM et al. (2005) En direct vaccin recombinant atténué protège les primates non humains contre les virus Ebola et Marburg. Nat Med 11, 786-90.
  • 15. Geisbert, TW et al. (2008) vecteur de virus de la stomatite vésiculeuse recombinant médiateur protection post-exposition contre le Soudan fièvre hémorragique Ebola chez les primates non humains. J Virol 82, 5664-8.
  • 16. Towner, JS, Sealy, les savoirs traditionnels, Ksiazek, T. & Nichol, ST (2007) de détection moléculaire à haut débit de menaces de virus de la fièvre hémorragique avec des applications pour les éclosions. J. Inf Dis 196 (suppl 2), S205-212.
  • 17. Towner, JS et al. (2006) en génomique et en association avec une importante épidémie de fièvre hémorragique de Marburg en Angola. J Virol 80, 6497-516.
  • 18. Posada, D. & Crandall, KA (1998) MODELTEST: tester le modèle de substitution de l’ADN. Bioinformatique 14, 817-818.
  • 19. Swofford, DL (2002) PAUP *: analyse phylogénétique en utilisant la parcimonie (* et d’autres méthodes) La version 4.0b10. Sinauer Assoc., Sunderland, Mass
  • 20. Felsenstein, J. (1985) Les limites de confiance sur les phylogénies: une approche utilisant le bootstrap. Evolution 39, 783-791.
  • 21. Ronquist, F. & Huelsenbeck, JP (2003) mrbayes 3: inférence phylogénétique bayésienne sous modèles mixtes. Bioinformatique 19, 1572-1574.
  • 22. Nylander, JAA, Wilgenbusch, JC, Warren, DL & Swofford, DL (2008) Awty (Are We There Yet?): Un système pour l’exploration graphique de convergence MCMC en phylogénétique bayésienne. Bioinformatique 24, 581-583.
Publicités

3 pensées sur “Brevet du virus Ebola! (déposé en 2009)”

Laisser un commentaire

Ce site utilise Akismet pour réduire les indésirables. En savoir plus sur comment les données de vos commentaires sont utilisées.